The same is true in human vs chimp comparisons. The DNA is the same even when there are other proteins that could do the same task. You haven't considered that large portions of DNA in both humans and chimps don't even code any proteins. They don't do anything at all. They're just along for the ride. And if you compare these against chimp DNA which also does nothing you'll find no more variation than you'd expect from a few million years of random mutation and other environmental changes.
It's time for a genetics lesson! (Not that I'm contradicting you, karajorma, just figured this could use some elaboration).
A lot of people don't understand the molecular mechanisms behind evolution, so here's a summarized lecture of a 400-level evo-devo class for free =)
The central dogma of molecular biology is that DNA is transcribed to RNA, which is translated into protein. Proteins are the workers of the cell: as enzymes, as ion channels, as linkers, as identifiers, and in dozens of other functions, proteins make life work.
At least, that's what we USED to think.
Turns out RNA can be reverse transcripted into DNA. RNA can also act as an enzyme - it can be a worker in the same capacity as protein. RNA can also act as an enzyme on itself, performing editing and self-cleavage functions. In some bacteria, RNA does as much work as proteins. In fact, a well-accepted hypothesis is that RNA actually existed before DNA or protein functions. DNA is more stable than RNA, so it has evolved as information storage. Proteins are more robust than RNA, so they function better as enzymes.
But, we've still got a problem in that RNA has kept these enzymatic functions - we see them in all forms of life. So why, if better mechanisms have evolved, does RNA still maintain these functions?
Two reasons: 1. because they work. 2. Flexibility.
People often cite that humans and chimps are 99% identical. That figure is actually misleading. Humans and chimps are 99% identical at the base-pair (code level). At the expression level, we're very different. For a long time humans were perplexed why some creatures have upwards of 150,000 protein-coding regions, yet humans only have between 35 and 45 thousand. The answer is RNA editing. We express millions (if not billions) of proteins, but we do it through complex regulation encoded in the "junk" DNA in our cell. RNA is instructed to self-edit. Thus, one coding fragment can produce a thousand different proteins.
Someone is probably asking what this has to do with chimps and humans and evolution.
Evolution is the great miser, traditionally. Whatever works, it keeps, and whatever doesn't, dies. But this isn't actually entirely true at the DNA level.
DNA doesn't have a perfect copying mechanism - far from it. Cells don't have backups (even the pairing scheme doesn't constitute a full backup for a variety of reason much too complex to explain here). So DNA frequently gets long "junk" regions that don't mean anything stuck in it, or long regions deleted. These regions are the mechanism of evolution on the molecular scale. Contrary to popular belief that mutation of protein-coding regions is what causes evolution, it's actually DNA modification in junk regions that drives evolution. Example:
Between the gene ALPHA1 and the gene BETA1 there could be a stretch of bases that runs GCTACAAAATTTTAAAATTTTAAAATTTTCG
Codons (triplets of bases) code for amino acids (protein building blocks). So, we have GCT-ACA-AAA-TTT-etc But this doesn't mean anything. It's junk DNA - it has no regulator, it has no start codon, it's got nothing. It has no function. But delete the first two bases (a common occurrence). Now the first codon is TAC. In RNA, that's AUG - the codon that signals for methionine, the start sequence of all protein translation. Suddenly, a region that COULD code for a protein is between two actual genes. What happens if one of those genes gets deleted, or misfunctions? It's regulatory region begins to act on the first available coding sequence. Suddenly we have a previously unknown protein appearing. This might be beneficial, or it might kill the organism. That's natural selection.
This is only one example. DNA breaks, re-aligns, deletes, adds bases, changes bases, adds regions, combines chromosomes, and generally acts in a way that's anything BUT completely stable. But if it was completely stable, nothing would evolve.
It's actually remarkable that any species DOES resemble another - and this is the basis on which we generate evolutionary trees. Complex algorithms are used to compare all regions, not just coding regions. What we find is that we can actually trace, at the molecular level, changes between organisms. Now, we can't estimate exactly what happened between species (there are approximately 3 billion base-pairs in human DNA, and we have a SMALL genome). 1% of 3 billion is 30 million base-pairs. Considering the average gene, including coding and regulatory regions, is only a few thousand base pairs, there's a lot of variation in 1%. Of course, most of that is regulatory regions and unknown elements that appear in "junk" DNA. In reality, while estimates for junk DNA in the cell usually fit somewhere about 50% of the total genome, that figure is probably much, much lower. We have nothing more than a basic grasp of how the human genome works.
So now that you know the details behind the mechanism, consider this: why is code conserved between humans and mice? Between humans and fungi? Betweens humans and protozoans? Betweens humans and reptiles? (I'm not touching bacteria here because there's an alternative explanation other than evolution). Obviously these regions are essential for life. And we can see how variation has occurred over time. Molecular genetics illustrates the variation that occurs at the DNA level between organismsms, which ultimately demonstrates how remarkably DIFFERENT all species are, yet also how remarkably similar. It's clear that humans are related to primates. It's clear that we're related to other mammals. And it's clear that species do change over time - there are genetic differences even between our ancestors 10,000 years ago and modern humans.
But, we're not a product of just our genes - our genes are a product of our environment. Environment favours certain types of gene expression, and rejects others. The driving force behind evolution is not genetic change - it's environmental change. Genetic plasticity is merely the mechanism by which it occurs. Even then, congenital and developmental defects are not always driven by changes at a genetic coding level - rather, gene expression is variable, and environment is what determines gene expression (and I'm referring to environment in the sense of anything surrounding DNA, including protein, lipid, other cells, viruses, bacteria, pathogenic host cells, dirt, metal ions, cellular-interactions, and everything right on up to the elephant that steps on your big toe). Thus, species occupy niches determined by a combination of their genes and the environment in which they develop.
Really, the only problem evolution poses for Creationists is thus: First, the age of the Earth. Second, the fact that life changes over time, rather than remaining static. Creationism is a plausible metaphor for understanding how life changes to occupy niches in a simplistic understanding. Evolution is how this occurs in an observable way.
But this brings up another bit of food for thought: Anyone who can look at DNA and think evolution is purely "random" is missing the big picture. A combination of genetic plasticity, developmental plasticity, and environmental plasticity drive evolution. Thus evolution is actually
directed by the forces of Nature, the laws of physics. If you want to define those forces and laws as "God in the details" you're welcome to. There is an elegance to life and natural laws that science cannot, and never will be able to fully explain. This is why humans have developed and (I argue) actually need some form of Faith (which may not be religious Faith, mind you). It is just necessary to remember that Faith should accomodate understanding, not oppose it.
Hope this made sense. If anyone has further questions, I have a shorter discussion on why many higher organisms look identical at a certain stage of development that illustrates this further, and perhaps a little more simplistically.
