Hard Light Productions Forums
Off-Topic Discussion => General Discussion => Topic started by: Ghost on February 12, 2007, 04:09:17 pm
-
http://www.darwinday.org/
How will you celebrate?
-
I'll be evolving :)
-
Aldo_14 Humor stat +1
What? Aldo_14 is evolving!
*Taa Daa*
Aldo_14 has evolved into Aldo_15!
I've been up since 1AM. I'm a little tired.
Please don't kill me.
-
....
-
Aldo_14 Humor stat +1
What? Aldo_14 is evolving!
*Taa Daa*
Aldo_14 has evolved into Aldo_15!
:lol:
Maybe it's just because I'm a long-time pokemon fan, but that really made me laugh! :D
-
I haven't heard anything about Darwin Day. It must be just a theory.
-
I haven't heard anything about Darwin Day. It must be just a theory.
Oooh, topical.
-
So is this the day when a large number of stupid people are supposed to remove themselves from the gene pool? Maybe thats why nobody called in for support today at work?
(Sorry...bad day)
-
Maybe because the idiots have killed themselves I'll finally get a good Shadow Labyrinth run? With people who have a clue about crowd control?
-
Darwin can suck it...
that evolutionist bastard
-
:rolleyes:
-
bleh, punctuated equilibria day is much cooler.
Props to Gould, screw Darwin
-
Darwin can suck it...
that evolutionist bastard
Calm down, just because great conservative heroes such as Mark Foley and Ollie North 'suck it' and come from questionable parentage doesn't mean you have to project that onto a 19th century naturalist.
I know you're trying to put him on the same pedestal as your own heroes for the sake of breaching the gap between two different socio-political ideologies but please... don't...
;)
-
I normally find the evolution debates on HLP exasperating, however...
It's been long enough since the last one that I've recovered since then and am ready for another 50+ page thread.
(This post is in no way to be interpreted as suggesting that this thread be turned into an evolution debate, merely that if it should take that course I won't mind so much.) :P
-
why not just necro the last one and pick up were we left off?
there is a link to it in Mefustae's sig, all you have to do is click it and post something, it's just... sitting there... is all I'm say'n
-
Darwin can suck it...
that evolutionist bastard
So speaks the presumably homosexual* Voice of Reason.
*expressly desiring fellatio from a victorian scientist with a fancy beard
-
MAYDAY MAYDAY
THIS IS THE H.M.S. HARD LIGHT THREAD UNDER ATTACK FROM UNIDENTIFIED ****STIRRER
REQUESTING IMMEDIATE FIGHTER COVER AND RESCUE
-
I can't help but notice to old evolution thread has not risen and become one with the living. I can only conclude that someone is.. chicken.
-
MAYDAY MAYDAY
THIS IS THE H.M.S. HARD LIGHT THREAD UNDER ATTACK FROM UNIDENTIFIED ****STIRRER
REQUESTING IMMEDIATE FIGHTER COVER AND RESCUE
Damnit, Captain! Where you gonna pull back to!? They're all over the perimeter! Now you be advised, you will hold and fight! Do you get me, Captain?
-
MAYDAY MAYDAY
THIS IS THE H.M.S. HARD LIGHT THREAD UNDER ATTACK FROM UNIDENTIFIED ****STIRRER
REQUESTING IMMEDIATE FIGHTER COVER AND RESCUE
Damnit, Captain! Where you gonna pull back to!? They're all over the perimeter! Now you be advised, you will hold and fight! Do you get me, Captain?
-Uh, roger your last, HLP. Can't run it any closer, we're hot-to-trot and packing ownage, but we'll make our fuel.
-For the record, Hammer, it's my call. Drop everything you got left on this thread! I say again, expend all remaining in my perimeter! Thanks for a loving ****in spam, HLP out.
Roger your last, HLP. We copy, it's your call. Get 'em in their holes down there, hang tough HLP...
-
MAYDAY MAYDAY
THIS IS H.M.S. HARD LIGHT THREAD UNDER ATTACK FROM UNIDENTIFIED ****STIRRER
REQUESTING IMMEDIATE FIGHTER COVER AND RESCUE
Adjusted for correctness. :D
I hate it when people use 'the' in front of H.M.S. as it's not actually used in Royal Navy circles. The only time 'the' is used to regard a British warship is when 'H.M.S.' is dropped from the name. Sometimes not even then! :D
Examples:
"This is H.M.S. Warspite, we have engaged enemy vessel."
"Send the Repulse to escort that convoy. Send Arethusa as well for good measure."
Okay, nitpick over. Sorry for the hijack..... :P
-
bleh, punctuated equilibria day is much cooler.
Punctuated equilibria is nothing more than stating very loudly a fact that was so obvious that no one thought it worth mentioning.
Darwin wins on the coolness.
Darwin can suck it...
Only cause he had lips thanks to evolution :p
-
Darwin can suck it...
that evolutionist bastard
Calm down, just because great conservative heroes such as Mark Foley and Ollie North 'suck it' and come from questionable parentage doesn't mean you have to project that onto a 19th century naturalist.
I know you're trying to put him on the same pedestal as your own heroes for the sake of breaching the gap between two different socio-political ideologies but please... don't...
;)
Yeah um.. anyone care to transilate?
And lol, one brief comment when im dead tired at 1 AM with no sleep the previous night.. and that caused a rupture in time, which caused this whole thread to become completely hijacked.
Sorry, my bad.
-
I might as well point out that Darwin is greatly overrated, due to the fact that much of his theories were in fact Lamarkian, as he theorised that change in species came from individuals developing adaptations from their behaviour. this theory was, of course, disproved by Genetics, and it wasn't until the 1920's that the modern theory of evolution (due to micromutations) was developed, after a few years of non-evolutionary theory concentrating on macro-mutations (think X-Men).
-
Calm down, just because great conservative heroes such as Mark Foley and Ollie North 'suck it' and come from questionable parentage doesn't mean you have to project that onto a 19th century naturalist.
I know you're trying to put him on the same pedestal as your own heroes for the sake of breaching the gap between two different socio-political ideologies but please... don't...
;)
Yeah um.. anyone care to transilate?
He's assuming that, because you made an anti-Darwin comment, you must be a Republican (Which is just plain Bull ****.*) and that therefore you admire people like Mark Foley (Sent lewd emails to pages) and Oliver North (Iran-Contra scandal). As such, he insults these people as a way of trying to hurt you, in the hopes that you'll go cry in a corner for a week and then come back as a extreme Democrat.
* I HATE when people do this, for two reasons:
1. Just because you don't like Darwin, doesn't mean you're a Conservative Christian. I know plenty of liberals (probably because I live in California) who completely hate the idea of evolution, because it goes against the idea that everyone is equal, and that you can be anything you want to be. Evolution REQUIRES that some of the species is "better" than the rest of the species. Not all of us can be successful, no matter how much you wish.
2. Just because someone is Republican (or conservative, if you don't live in the US) doesn't mean that you don't believe in evolution. I'm a Republican (or a Libertarian, I haven't decided yet), and I'm not this way because I don't believe in Evolution, or the Big Bang, or Global Warming, or whatever you want to blame on me this week. I'm this way because I don't like a large Federal Government. I'd much rather have the laws that apply to me made by people who know what I want, instead of by people who have to balance what I want with what people in New Hampshire want. Better the foe you know than the one you don't.
Sorry to shake your world view, but some of us Republicans AREN'T the ignorant bible-belt hicks you like to portray us as. (No offense to anyone from said area.)
-
I can't help but notice to old evolution thread has not risen and become one with the living. I can only conclude that someone is.. chicken.
I'd bump it just to get the ball rolling, except that I'm with the majority (of HLP) on this issue. The only one I know around here who might argue against evolution would be Chara and I think he's learned it's futile to argue that on HLP. :blah:
-
I can't help but notice to old evolution thread has not risen and become one with the living. I can only conclude that someone is.. chicken.
I'd bump it just to get the ball rolling, except that I'm with the majority (of HLP) on this issue. The only one I know around here who might argue against evolution would be Chara and I think he's learned it's futile to argue that on HLP. :blah:
If he was reading said huge-o-mognous thread, he should be aware it's wrong, let alone futile. I mean, he did say he was reading the responses, and every attempt to 'fail' evolutionary theory was pretty comprehensively replied to and disproven, usually by several people.
-
I might as well point out that Darwin is greatly overrated, due to the fact that much of his theories were in fact Lamarkian, as he theorised that change in species came from individuals developing adaptations from their behaviour. this theory was, of course, disproved by Genetics, and it wasn't until the 1920's that the modern theory of evolution (due to micromutations) was developed, after a few years of non-evolutionary theory concentrating on macro-mutations (think X-Men).
Did you READ "On The Origin of Species"?
Darwin proposed natural selection. That is, that individuals in a species die off or reproduce according to the physical traits they possess and are capable of passing on to their offspring. Lamarck proposed that physical changes were heritable. Darwin's theory operates on a species level - traits are selected for and passed along in the species. And behavioural adaptation is, in part, genetic. Certain behaviours are selected for (via death vs reproduction), and even if behaviour itself isn't coded genetically (and its surprising how much of it can be, actually) the trait basis of behaviour is - things like temperament. The only problem Darwin had was he didn't know the mechanism of heritability, which is ironic because he had in his possession Mendel's work on peas.
In summary... Darwin was by no means the first to propose evolution, BUT he was the first to propose the mechanism by which it occurs - natural selection. He also provided evidence for it.
As for modern genetics, it has done nothing but complement Darwin's work, providing the basis of trait formation. As it was, genetics didn't even manage to identify the heritable material until 1953. Since then, we've learned that a variety of mutations, both micro and macro (but all on a genetic level) contribute to both phenotype and behaviour, all of which influence selection processes.
Darwin never proposed that he knew how heritable traits were coded (which again, he might have figured out if he read Mendel), and his work has been the grounding point for modern biology and psychology since. It is difficult to overstate the impact Darwin's work has had on modern biology, including genetics (which, incidentally, I have a B.Sc Specialization in).
-
Darwin never proposed that he knew how heritable traits were coded (which again, he might have figured out if he read Mendel)
I remember my biology teacher telling me this. Mendel's book was found, uncut, in Darwin's library. He had ordered it a little while before his (Darwin's) death (if I remember correctly), so he never got the chance to see his work supported.
I also remember the Lamarckian hypothesis - it made me laugh. (It was based, literally, around giraffes. A giraffe stretches its neck out to get leaves, ergo its offspring have long necks.)
-
I know plenty of liberals (probably because I live in California) who completely hate the idea of evolution, because it goes against the idea that everyone is equal, and that you can be anything you want to be. Evolution REQUIRES that some of the species is "better" than the rest of the species. Not all of us can be successful, no matter how much you wish.
No, all it means is that people with more surviving kids are the ones passing on their genes. They aren't intrinsically better, they're just the survivors.
Just because reality doesn't conform to what either the far right (religious nutzos) or far left (postmodernist nutzos) want it to be doesn't mean you should be angsty. It means you should get with the program! ;)
-
Evolution REQUIRES that some of the species is "better" than the rest of the species. Not all of us can be successful, no matter how much you wish.
I think you're misinterpreting Darwin's ideas just a little. Evolution only requires that there be variation within a population. "Better" is a subjective term, and is dependent on those practically random (in the original Darwinian view) phenomena that determine the "survival of the fittest." Sidetrack example: White moths might be "better" at flying than black moths, but when the forest gets covered in soot, the black moths will survive.
More pertinently (and not to defend the "liberal" point of view), human success is not predicated on the relative merit of one's genes. (Yes, humans have some qualities that other animals don't. Get over it, anthropocentrism freaks.) The fact that you and I can engage in intellectual discussion, while we come from very different segments of the population, helps to show that environment (as Darwin would have said) plays a major role in shaping how your phenotypes express themselves.
If you take a look at "successful" people - those you define as successful included - you will note that they come from a wide variety of backgrounds. The conclusion that genetics plays a major factor, when drawn from empirical data, is shoddy at best and erroneous at worst.
Moreover, I think modern educational systems as a whole have tended to explode the idea that the academic (or otherwise) merit of students is rooted in who their parents were, or a point mutation on chromosome 17.
Is everyone equal? Let's rephrase that. Everyone, excepting persons who have their learning/physical capacities severely limited, has the potential to attain "success." However, it is their environment (including economic conditions, life at home, school, etc.) coupled with, but not limited to, the exertions of the individuals themselves, that brings "success" to fruition.
You'd be surprised at the numbers of "liberals" that are adopting this basically Social-Darwinist point of view. No offense to you, but it seems like a cop-out for researching and understanding that the majority of folks living in Watts* aren't there because they are retarded, unfit, or like it there.
*replace with your ghetto of choice
-
More pertinently (and not to defend the "liberal" point of view), human success is not predicated on the relative merit of one's genes. (Yes, humans have some qualities that other animals don't. Get over it, anthropocentrism freaks.)
By 'qualities other animals lack' you're referring to language and tool-making (which in the end combine to form culture). Which is shared by other primates. Obviously humans have a greater degree of this than Gorillas or Chimpanzees but it is shared by "animals." Orangutans rape, Gorillas pass on sign language to children and obviously have the capacity for symbolic systems, Chimps make tools to eat termites (which are yes... taught) almost as complex as the tools we used for a great deal of human existence. The Berlin wall we've constructed separating ourselves from other species is one made out of paper.
-
No other animal has language. Don't even get me started on that 'cause I just woke up from a nap and I'm grumpy.
-
Also:
http://news.bbc.co.uk/2/hi/science/nature/6356773.stm
Bam! Chimp ancestors using stone tools. Let's face it if you've done even a basic study of lithics most human and human ancestor tools were just like that. Grab a rock, smack something off of the core to use to smash a nut, and toss it aside.
Humans aren't that special, they're just super atomic mutants that take traits seen in our relatives and blow them into utterly absurd levels, with of course a delusional personalistic worldview that developed which goes along with it.
-
I'm talking about language, not tools. The two are a chasm apart.
EDIT: Sorry if that wasn't a response to my last post. Again, nap... confused.
-
I can't help but notice to old evolution thread has not risen and become one with the living. I can only conclude that someone is.. chicken.
I'd bump it just to get the ball rolling, except that I'm with the majority (of HLP) on this issue. The only one I know around here who might argue against evolution would be Chara and I think he's learned it's futile to argue that on HLP. :blah:
If he was reading said huge-o-mognous thread, he should be aware it's wrong, let alone futile. I mean, he did say he was reading the responses, and every attempt to 'fail' evolutionary theory was pretty comprehensively replied to and disproven, usually by several people.
Glad to know I earned a Rep. That perticular one, at that.
I do not believe it's futile, just, that im not the one to be doing it (the pro side). I RESPECT that you guys had a clan and ('proof') a answer for each thing i brought up (nor near, every point that i brought up). Its been a while so dont bash me for being incorrect here.
Just you guys seemed to love to bash books and quots and links and vids over my head, drowndin me in a sea of 'sence ur last reply, you have 20 pages, 100 links and 5 ten minute videos to read and memorize before you can even begin to think of how to reply, and you have 5 minutes to reply unless you want to have another 15 pages added on...etc' and seemed to feel big by doing it. I got the jist that you guys (yeah i spelt gist wrong) did not realize that you were socalled 'disprooving' a meer normal person who did NOT do research to reply (in most cases. I was very buzy at the time with schoolwork and reports..much less, work) and as said did not have the time to in detail. You guys shoulda cut me some slack, and at least, respected the fact that i was teh ONLY (except Zman, and 1-2 others who wishted to 'stay out of it') who realy stood up for my side, as best i could at the time.
But my point: I am not a priest (lol..catholics), minister, or profit or whoever.. some learneded 'i know every page in the bible by heart' person who is a professional and knows the ins and outs of my faith and my beleif. I am not that person. I am a ordinary person with my own beleifs. i am not a professor or priest and of corse i do not know all the defences or proofs that people in those positions know. So i do beleive the Christian side has proof and evidecne, and things to back up what i said , or most of it, (or things to back up with i Tried to say, but was incorrect in some form) but i honestly dont know them right now.
Heh. And my name (SN anyways) is (should be) Ephili.
(i have been tryign to change my nick to Ephili for some time now, by only sighning my paragraphs with Ephili instead of Chara.)
-
Heh. And my name (SN anyways) is (should be) Ephili.
(i have been tryign to change my nick to Ephili for some time now, by only sighning my paragraphs with Ephili instead of Chara.)
You know, back when you migrated from the VWBB to here, I told you that in order to seem less like a noob, you really shouldn't keep being schizophrenic and call yourself both Charismatic and Ephili -- you'd have to pick one and stick with it. You told me you'd pick Charismatic.
I guess you haven't changed. :blah:
-
More pertinently (and not to defend the "liberal" point of view), human success is not predicated on the relative merit of one's genes. (Yes, humans have some qualities that other animals don't. Get over it, anthropocentrism freaks.)
By 'qualities other animals lack' you're referring to language and tool-making (which in the end combine to form culture). Which is shared by other primates. Obviously humans have a greater degree of this than Gorillas or Chimpanzees but it is shared by "animals." Orangutans rape, Gorillas pass on sign language to children and obviously have the capacity for symbolic systems, Chimps make tools to eat termites (which are yes... taught) almost as complex as the tools we used for a great deal of human existence. The Berlin wall we've constructed separating ourselves from other species is one made out of paper.
Whoa there, Ace. I didn't delineate any specific differences like language and tool-making in my original post, so you're jumping the gun a bit there. :) Understandable, though. Evolution is a subject on which many passions get inflamed very quickly.
On the subject of languages, however: Lower primate language is just that - less complex than our own. If you're going to bring up the similarities between humans and lower primates, you should also mention the differences. We have a greatly enlarged brain extended by 2 modes: 1) possibly a mutation and 2) definitely better eating habits, such as denaturing protein by means of fire, etc. Thus, we gained the ability to have more complex social and linguistic behavior, which spurred what we call "progress" in human history. All that good stuff like writing.
Again, I am not arguing that we are wholly dissimilar to other species. But, as my biology teacher put it, we are the only species to recognize ourselves as such via the all-important process of increased (not new) intuition and reasoning.
To put it another way - I don't see any chimps posting on this message board, excepting He-Who-Shall-Not-Be-Named (derek smart.. duh). Paper wall or not, I still clutch on to the distinction. Let's agree to peacably disagree on this one.
-
fsi.scsi:
The difference between humans and our lower primate cousins is due to increases in cognition. Basically, humans have a more advanced capability for self-awareness (which is not to say other species don't).
As for where our large brains came from, brain size doesn't matter so much as brain structure size (and when it comes to relative size of structures, humans reign supreme with a very large telencephalon: cortex and the like). And its development is one of the great wonders of evolution - whereas most other species have concordant rates of phenotypic and behavioural evolution, human behavioural evolution has for outstripped our biological evolution (in many cases, this causes severe problems for us too). That's the different between Homo sapiens and everything else - our behaviour no longer matches our biological constraints. We're niche-building, not niche-occupying. The fundamental principles remain the same.
And whil those larger brains make us think we're smart, I tend to think the porpoises have the right idea - live in a warm ocean where you don't need technology, eat, play, and mate all day. We're the dumb ones. Hell, as if life wasn't hard enough, we went and constructed modern society with its technology, economic systems, and stresses that shorten our lives.
I want to come back as a dolphin. Seriously. I should become a Buddhist.
-
He's assuming that, because you made an anti-Darwin comment, you must be a Republican (Which is just plain Bull ****.*)
To be fair you're assuming that he hasn't talked to Charismatic before and isn't completely sure that he's a Republican. :p
But my point: I am not a priest (lol..catholics), minister, or profit or whoever.. some learneded 'i know every page in the bible by heart' person who is a professional and knows the ins and outs of my faith and my beleif. I am not that person. I am a ordinary person with my own beleifs. i am not a professor or priest and of corse i do not know all the defences or proofs that people in those positions know. So i do beleive the Christian side has proof and evidecne, and things to back up what i said , or most of it, (or things to back up with i Tried to say, but was incorrect in some form) but i honestly dont know them right now.
And that's the problem Charismatic.
If you don't know enough to understand that stuff how can you possibly know it's correct? How can you know that they aren't lying to you and saying that they are correct when they are in fact lying through their teeth? Yet again you're back to taking things on faith. You believe that the Christian side has proof because you want to believe that.
You've come on here and said that people are wrong. When they ask you "Why am I wrong?" your only response is to point elsewhere and say "I don't understand why but he told me so." But the problem with that is that when we check why this person actually say we're wrong we find poor logic, errors and outright lies.
Charismatic, you are being lied to. The Christian church does not have proof that evolution is wrong. That's why the Catholic church with 1 billion members finally admitted defeat over 10 years ago and said that Darwin was right. If there was real proof why do you think they would have done that?
-
If you don't know enough to understand that stuff how can you possibly know it's correct? How can you know that they aren't lying to you and saying that they are correct when they are in fact lying through their teeth? Yet again you're back to taking things on faith. You believe that the Christian side has proof because you want to believe that.
You've come on here and said that people are wrong. When they ask you "Why am I wrong?" your only response is to point elsewhere and say "I don't understand why but he told me so." But the problem with that is that when we check why this person actually say we're wrong we find poor logic, errors and outright lies.
Charismatic, you are being lied to. The Christian church does not have proof that evolution is wrong. That's why the Catholic church with 1 billion members finally admitted defeat over 10 years ago and said that Darwin was right. If there was real proof why do you think they would have done that?
That's the overall issue with people like him. He doesn't know he's wrong, because he's completely convinced, to the very core of his being, that he is right. But then, it's not totally his fault:
When he was a child, he was undoubtedly entertained with a thrilling story of a grand Deity that watched over mankind, and that every human being - including him, playing on his ego - was special and part of His grand plan for the Universe. As a child, you really don't have any defense against being told something like that, as you automatically assume what your elders tell you is unequivocally true. Ironically, this evolutionary survival mechanism actually works against the very process that created it.
As he ages and becomes more receptive to logical thought, he is confronted with data that directly contradicts what he was told as a youth. He is exposed to the wondrous discoveries of modern science. Unfortunately, since he has already taken the stories he was told as fact, he simply dismisses this new data as false. In his mind, he has resolved that the stories he was told as a wee lad simply can't be false, and therefore he makes the logical conclusion that this new data must be false.
In time, he will pass on the stories of this grand Deity to his own young, and thus he will continue the vicious cycle that perpetuates religious dogma in the face of overwhelming evidence to the contrary.
-
If he was reading said huge-o-mognous thread, he should be aware it's wrong, let alone futile. I mean, he did say he was reading the responses, and every attempt to 'fail' evolutionary theory was pretty comprehensively replied to and disproven, usually by several people.
Glad to know I earned a Rep. That perticular one, at that.
I do not believe it's futile, just, that im not the one to be doing it (the pro side). I RESPECT that you guys had a clan and ('proof') a answer for each thing i brought up (nor near, every point that i brought up). Its been a while so dont bash me for being incorrect here.
Just you guys seemed to love to bash books and quots and links and vids over my head, drowndin me in a sea of 'sence ur last reply, you have 20 pages, 100 links and 5 ten minute videos to read and memorize before you can even begin to think of how to reply, and you have 5 minutes to reply unless you want to have another 15 pages added on...etc' and seemed to feel big by doing it. I got the jist that you guys (yeah i spelt gist wrong) did not realize that you were socalled 'disprooving' a meer normal person who did NOT do research to reply (in most cases. I was very buzy at the time with schoolwork and reports..much less, work) and as said did not have the time to in detail. You guys shoulda cut me some slack, and at least, respected the fact that i was teh ONLY (except Zman, and 1-2 others who wishted to 'stay out of it') who realy stood up for my side, as best i could at the time.
But my point: I am not a priest (lol..catholics), minister, or profit or whoever.. some learneded 'i know every page in the bible by heart' person who is a professional and knows the ins and outs of my faith and my beleif. I am not that person. I am a ordinary person with my own beleifs. i am not a professor or priest and of corse i do not know all the defences or proofs that people in those positions know. So i do beleive the Christian side has proof and evidecne, and things to back up what i said , or most of it, (or things to back up with i Tried to say, but was incorrect in some form) but i honestly dont know them right now.
Heh. And my name (SN anyways) is (should be) Ephili.
(i have been tryign to change my nick to Ephili for some time now, by only sighning my paragraphs with Ephili instead of Chara.)
Intelligent discourse is not about 'standing up for your side'. It is about the weight of supporting and disproving evidence, and addressing the issue. The criticisms you made were overturned and corrected by a multitude of reputable sources, hence we posted those sources to indicate both the quantity and quality of information that, to be blunt, proved you wrong.
I would point out that many of those replying are not scientists or researchers but simply people with open eyes and open minds; I am simply a computer programmer who likes reading biological 'stuff' and made his own mind up. I would also point out the dangers of relying upon 'authority' sources; I've seen many times where creationists have placed quotes supporting them that are either a) in some way falsified or b) by people with vested financial interests in promoting creationism. Again, I (we) post multiple (many) sources to counteract this and show consensus across the scientific community - rather than some paid mouthpiece for the Discovery Institute.
In any case, it is futile because it is too weak and nebulous an argument; it is like fighting the SAS with a potato gun.
-
Heh. And my name (SN anyways) is (should be) Ephili.
(i have been tryign to change my nick to Ephili for some time now, by only sighning my paragraphs with Ephili instead of Chara.)
You know, back when you migrated from the VWBB to here, I told you that in order to seem less like a noob, you really shouldn't keep being schizophrenic and call yourself both Charismatic and Ephili -- you'd have to pick one and stick with it. You told me you'd pick Charismatic.
I guess you haven't changed. :blah:
I remember that conversation. Its probably still in my PM's. I thought I picked Ephili. Lol, my bad.
But I did choose (beit, later on). Lol life is confuzng.
*snip*
But my point: I am not a priest (lol..catholics), minister, or profit or whoever.. some learneded 'i know every page in the bible by heart' person who is a professional and knows the ins and outs of my faith and my beleif. I am not that person. I am a ordinary person with my own beleifs. i am not a professor or priest and of corse i do not know all the defences or proofs that people in those positions know. So i do beleive the Christian side has proof and evidecne, and things to back up what i said , or most of it, (or things to back up with i Tried to say, but was incorrect in some form) but i honestly dont know them right now.
And that's the problem Charismatic.
If you don't know enough to understand that stuff how can you possibly know it's correct? How can you know that they aren't lying to you and saying that they are correct when they are in fact lying through their teeth? Yet again you're back to taking things on faith. You believe that the Christian side has proof because you want to believe that.
You've come on here and said that people are wrong. When they ask you "Why am I wrong?" your only response is to point elsewhere and say "I don't understand why but he told me so." But the problem with that is that when we check why this person actually say we're wrong we find poor logic, errors and outright lies.
Charismatic, you are being lied to. The Christian church does not have proof that evolution is wrong. That's why the Catholic church with 1 billion members finally admitted defeat over 10 years ago and said that Darwin was right. If there was real proof why do you think they would have done that?
I will ask my dad tonight for sure. No i am not going to give you the 'its all on faith'. As said i believe there is proof. But, we can get into that later; as i will ask my dad what he knows, tonight.
But, I will tell you this, and I am sure I said this in the other EVOlution topic. I have not simply relyed on faith all my life. I have seen proof. Proof to me. I have had some experiances, that are a non repeatable experiance. Prayers have been answered in an instant, when there was no forseeable way for it to happen. God has gotten me out of some situations that i thought were impossible to get out of, expecially on such short notice. God has proven himself over and over to me. God does that to some people. He proves himelf to each in his own way. The way He proved himself to me, wont cut it for someone else, and vise versa.
One perticular experiance was this. And this is of a personal experiance, so please watch how you say what u say in your replys to this.
I was at a meething with a Prophet. There was like 50 or less of us there. He taught what he came to teach like normal, but then he got the impression (God, IIRC) to do something different. He got a ShoFar, and poured oil into it; and he anointed people as they came up. And comeing up was vollentary. He would pray for them as he anointed them (poured the oil into the shofar, and let it come out the other end onto their head's) and for some, God would speak through the prophet, and proficy over the one being annointed. I went up. He prayed, proficyed over me, and annointed me. Now, after he annointed me, and the pouring of the oil stopped, i still felt it spilling over my head (in no small ammount). And i was instructed to walk to the side, because my 'turn' so to speak, was over. God said what he needed to say to me. As I walked away i still felt it pouring onto my head, and he said it was God who was annointing me, and thats why i could feel it. I felt the presure of hte oil hitting my head, in a continueous flow so to speak. As i walked i walked carefull, and slow, so i would not 'loose' the flow, i walked as so it would still hit my head as i moved. if that makes sence.
Example. A dish is on ur head. U ballance and walk slowly. You know if you run, it will fall and it wont be on ur head anymore.
And it stopped eventually but thats not the point.
As other proof, something happened that day between me and my friend, when i was at home alone earlier that day. No parents home. No one could have known. In the proficy, he mentioned what happened that day between me and my friend. God saw waht happened and spoke through the Prophet to me, to proove the words that were being spoken in the Porficy were from God, and not just from any preacher.
I still have that proficy typed up. It was my first.
-
I was at a meething with a Prophet. There was like 50 or less of us there. He taught what he came to teach like normal, but then he got the impression (God, IIRC) to do something different. He got a ShoFar, and poured oil into it; and he anointed people as they came up. And comeing up was vollentary. He would pray for them as he anointed them (poured the oil into the shofar, and let it come out the other end onto their head's) and for some, God would speak through the prophet, and proficy over the one being annointed. I went up. He prayed, proficyed over me, and annointed me. Now, after he annointed me, and the pouring of the oil stopped, i still felt it spilling over my head (in no small ammount). And i was instructed to walk to the side, because my 'turn' so to speak, was over. God said what he needed to say to me. As I walked away i still felt it pouring onto my head, and he said it was God who was annointing me, and thats why i could feel it. I felt the presure of hte oil hitting my head, in a continueous flow so to speak. As i walked i walked carefull, and slow, so i would not 'loose' the flow, i walked as so it would still hit my head as i moved. if that makes sence.
Example. A dish is on ur head. U ballance and walk slowly. You know if you run, it will fall and it wont be on ur head anymore.
Similar thing happens to me when I'm wearing safety goggles for awhile (similar constant-pressure-applied-to head-situation.) As soon as I take them off, it still feels like theyre on for a few more minutes.
-
Chara, evolution doesn't presuppose that God does not exist. I'm a molecular biologist - and I don't believe in a Christian conception of God, but I certainly do believe in a higher power.
This is why the evolution/creation debate is so asinine - it isn't a debate. Evolution is a theory (which by scientific definition can never be proven, much like gravity, molecular motion, thermodynamics, all of which our modern life is based upon) which explains observable phenomena - namely that life changes over time. This isn't contestable - it's widely documented, and we can easily see it.
But the idea that life changes and evolves over time does not negate Faith, nor does the idea that all life on Earth has ultimately come from simpler forms of life mean that modern species should be "devalued" in any way - in fact, that very notion is a conception which emerged from Christian scholars in an attempt to ridicule the proposition of natural selection.
This is what people need to get their heads around: evolution/creation is NOT a dichotomy. It's not one or the other. It can be both. The Bible has plenty of contradictory elements throughout it - that doesn't mean its lessons are any less valuable. It simply means that it is a compilation of men in an effort to understand their Faith in God. Genesis is a fantastic metaphor for how life began, and for recognizing that cognition endows men with a responsibility (which is what the idea of original sin is all about).
I'm not a Christian, and I have plenty of problems with the Christian church. BUT, acceptance of evolutionary theory doesn't mean you can't have Faith - it simply means that someone is not so foolhardy as to believe in the absolute supremity of a document assembled by men over thousands of years.
And I'll save you some time - there is no 'evidence' which supports Creationism. There IS evidence that evolutionary theory has difficulty explaining. This doesn't mean the theory is wrong, it simply means the theory needs revision. There are occurences which contradict the theory of gravity too - does that mean that it doesn't exist? Of course not.
The only people who debate the validity of evolutionary theory are people who do not understand what it actually says or means.
-
Charismatic, you are being lied to. The Christian church does not have proof that evolution is wrong. That's why the Catholic church with 1 billion members finally admitted defeat over 10 years ago and said that Darwin was right. If there was real proof why do you think they would have done that?
Well to be honest that was at the same time that they finally admitted that Galileo was right. Last time I checked I don't see televangelists screaming that there aren't any craters on the moon or moons of Jupiter... Though their proud cathedral equivalents did for quite some time ;)
Also... am I the only one who sees a problem with having 'prophets' when the entire theological basis of protestantism is reading the bible for yourself and having your own interpretations? What the frak is going on?
-
But, I will tell you this, and I am sure I said this in the other EVOlution topic. I have not simply relyed on faith all my life. I have seen proof. Proof to me. I have had some experiances, that are a non repeatable experiance. Prayers have been answered in an instant, when there was no forseeable way for it to happen. God has gotten me out of some situations that i thought were impossible to get out of, expecially on such short notice. God has proven himself over and over to me. God does that to some people. He proves himelf to each in his own way. The way He proved himself to me, wont cut it for someone else, and vise versa.
One perticular experiance was this. And this is of a personal experiance, so please watch how you say what u say in your replys to this.
I was at a meething with a Prophet. There was like 50 or less of us there. He taught what he came to teach like normal, but then he got the impression (God, IIRC) to do something different. He got a ShoFar, and poured oil into it; and he anointed people as they came up. And comeing up was vollentary. He would pray for them as he anointed them (poured the oil into the shofar, and let it come out the other end onto their head's) and for some, God would speak through the prophet, and proficy over the one being annointed. I went up. He prayed, proficyed over me, and annointed me. Now, after he annointed me, and the pouring of the oil stopped, i still felt it spilling over my head (in no small ammount). And i was instructed to walk to the side, because my 'turn' so to speak, was over. God said what he needed to say to me. As I walked away i still felt it pouring onto my head, and he said it was God who was annointing me, and thats why i could feel it. I felt the presure of hte oil hitting my head, in a continueous flow so to speak. As i walked i walked carefull, and slow, so i would not 'loose' the flow, i walked as so it would still hit my head as i moved. if that makes sence.
Example. A dish is on ur head. U ballance and walk slowly. You know if you run, it will fall and it wont be on ur head anymore.
And it stopped eventually but thats not the point.
As other proof, something happened that day between me and my friend, when i was at home alone earlier that day. No parents home. No one could have known. In the proficy, he mentioned what happened that day between me and my friend. God saw waht happened and spoke through the Prophet to me, to proove the words that were being spoken in the Porficy were from God, and not just from any preacher.
I still have that proficy typed up. It was my first.
Do you even realise that not a single word you have typed in this entire section is relevant to whether or not evolution is true?
The matter under discussion is not whether or not God exists. You hear people say that evolution is true and automatically assume that they are saying that God isn't. This is not the case. There are many protestant and catholic biologists who completely believe in God and yet still understand that creationism is complete bunkum.
So even if I believed you were correct about every single thing you've just typed it wouldn't matter one iota as to whether or not evolution is true. That's why I brought up the point of the Pope saying that evolution is true. Are you going to claim the Pope doesn't believe in God now? :D
-
I will ask my dad tonight for sure. No i am not going to give you the 'its all on faith'. As said i believe there is proof. But, we can get into that later; as i will ask my dad what he knows, tonight.
But, I will tell you this, and I am sure I said this in the other EVOlution topic. I have not simply relyed on faith all my life. I have seen proof. Proof to me. I have had some experiances, that are a non repeatable experiance. Prayers have been answered in an instant, when there was no forseeable way for it to happen. God has gotten me out of some situations that i thought were impossible to get out of, expecially on such short notice. God has proven himself over and over to me. God does that to some people. He proves himelf to each in his own way. The way He proved himself to me, wont cut it for someone else, and vise versa.
One perticular experiance was this. And this is of a personal experiance, so please watch how you say what u say in your replys to this.
I was at a meething with a Prophet. There was like 50 or less of us there. He taught what he came to teach like normal, but then he got the impression (God, IIRC) to do something different. He got a ShoFar, and poured oil into it; and he anointed people as they came up. And comeing up was vollentary. He would pray for them as he anointed them (poured the oil into the shofar, and let it come out the other end onto their head's) and for some, God would speak through the prophet, and proficy over the one being annointed. I went up. He prayed, proficyed over me, and annointed me. Now, after he annointed me, and the pouring of the oil stopped, i still felt it spilling over my head (in no small ammount). And i was instructed to walk to the side, because my 'turn' so to speak, was over. God said what he needed to say to me. As I walked away i still felt it pouring onto my head, and he said it was God who was annointing me, and thats why i could feel it. I felt the presure of hte oil hitting my head, in a continueous flow so to speak. As i walked i walked carefull, and slow, so i would not 'loose' the flow, i walked as so it would still hit my head as i moved. if that makes sence.
Example. A dish is on ur head. U ballance and walk slowly. You know if you run, it will fall and it wont be on ur head anymore.
And it stopped eventually but thats not the point.
As other proof, something happened that day between me and my friend, when i was at home alone earlier that day. No parents home. No one could have known. In the proficy, he mentioned what happened that day between me and my friend. God saw waht happened and spoke through the Prophet to me, to proove the words that were being spoken in the Porficy were from God, and not just from any preacher.
I still have that proficy typed up. It was my first.
This doesn't relate to the scientific - or even rational, logical and common sense - relevance of evolutionary theory. It relates to your opinion of a human being who tells you things.
Your experiences - neither of which to me sound anything like proof to anyone beyond someone already looking to believe (suggestion is very powerful - I'd suggest looking up someone called Darren Brown, who managed to convince a number of groups that he has what might be termed supernatural insight through simple psychological tricks - and remember you volunteered to have oil poured on yer noggin, so you were displaying openness to suggestion) - don't relate to this issue, unless you only ever listen to one person. And if you do, then that person - not a supernatural diety with omnipotence and omniscence - has become your God. Because if you believe God made us what we are, he wouldn't give us a brain and not want us to use it. If God made humankind special, then surely that specialness lies in the curiousity, the reasoning, the imagination and thought that we possess above all other animals?
-
Discussing the existence or non-existence of God is the last refuge of the Creationist in trouble. By drawing the other side into a philosophical argument over the existence and motives of God they can avoid having to face up to the fact that there is no actual proof for Creationism and argue on grounds they feel more comfortable on than sheer, unrelenting scientific fact.
It's a huge mistake to allow yourself to be drawn in on such matters as there is always wiggle room when it comes to this kind of argument. Far better to stick to the scientific facts and prove that creationism is full of **** by showing the scientific proof of why it is wrong than getting into an argument that can't ever be won.
-
This is perfectly revelant. And no, Kara, i am not a creationist in troulbe. I am just fine.
Let me explain this to you guys, because you dont get it.
Someone stated that i beleive the lies the christians tell me, without any proof or second thought.
So, i explained clearly, that my beleif in God and other christian beleifs, and beleifs agiesnt evolution etc, had more basis, more ground then just 'he told me that'. I told you guys a personal experiance, one of many, that prooved to me that God is real and that the christian faith is not bull****.
So it is revelant.
I am not trying to proove the existance of god so to speak, i was in the case of, showing and defending why i beleive in god and creationist beleifs. Cauze God has prooved himself to me.
And also[I*Snip*]
This doesn't relate to the scientific - or even rational, logical and common sense - relevance of evolutionary theory. It relates to your opinion of a human being who tells you things.
Your experiences - neither of which to me sound anything like proof to anyone beyond someone already looking to believe (suggestion is very powerful - I'd suggest looking up someone called Darren Brown, who managed to convince a number of groups that he has what might be termed supernatural insight through simple psychological tricks - and remember you volunteered to have oil poured on yer noggin, so you were displaying openness to suggestion) - don't relate to this issue, unless you only ever listen to one person. And if you do, then that person - not a supernatural diety with omnipotence and omniscence - has become your God. Because if you believe God made us what we are, he wouldn't give us a brain and not want us to use it. If God made humankind special, then surely that specialness lies in the curiousity, the reasoning, the imagination and thought that we possess above all other animals?
Please look at how i worded things, and explained it. How and the hell can he get it right, what happened earlier that day, one and a million things, out of me just walking up there. I said nothing, did nothing else that screamed the word 'fight with friend'. Hell my dad did not even know. I know about that guy and what he dose. But this is oviusly different.
Meh, my point. It was not a man saying **** to me. It was God. God can 'use' people so to speak. He can speak through people, or circumstances. So for my case, it was not a man speaking to me, it was God.
And yes i did use the word Prophet. Look it up.
-
Char, what do you think when you see a talented magician? Do you automatically assume he has some divine connection simply because the scientifically explainable logic of the situation is simply hidden behind a clever trick?
-
Let me explain this to you guys, because you dont get it.
Someone stated that i beleive the lies the christians tell me, without any proof or second thought.
So, i explained clearly, that my beleif in God and other christian beleifs, and beleifs agiesnt evolution etc, had more basis, more ground then just 'he told me that'. I told you guys a personal experiance, one of many, that prooved to me that God is real and that the christian faith is not bull****.
So it is revelant.
No it isn't. No one questioned if God was real. No one said Christianity was bull****. You heard those words in your head the second someone starts saying that creationism is bull****. So stating your reasons why you think he is real was an enormous waste of time. Unless God personally told you that evolution was false your belief that it is wrong is still based on some human telling you that it's wrong.
You can repeat your refrain that since God exists it must therefore mean that evolution must be wrong all you like but it's simply not true unless you're claiming direct divine inspiration for your belief against evolution rather than simply for your belief in God.
-
Please look at how i worded things, and explained it. How and the hell can he get it right, what happened earlier that day, one and a million things, out of me just walking up there. I said nothing, did nothing else that screamed the word 'fight with friend'. Hell my dad did not even know. I know about that guy and what he dose. But this is oviusly different.
Meh, my point. It was not a man saying **** to me. It was God. God can 'use' people so to speak. He can speak through people, or circumstances. So for my case, it was not a man speaking to me, it was God.
And yes i did use the word Prophet. Look it up.
People can get it right very easily, it's a simple matter of reading subconscious psychological cues and signals. In some cases this is a trained ability, in others it's intuitive. It does not equate to foresight or omniscence.
What, tell me, did he say? How exact is it?
My point is simple; throughout history people have claimed to speak on behalf of God, or Gods - be it from the oracle at Delphi to David Koresh. In many cases they are extremely charistmatic and use subtle persuasive techniques that, to those already wishing and willing to believe in them, appear supernatural.
It's quite late, so unfortunately I don't have the time to watch and double check, but I suggest you view this - http://www.youtube.com/watch?v=vKhN1Jfv_s8
I believe there is an inherent danger, whether you are religious or not, in assuming supernatural or divine powers without understanding how they can be faked.
(oh, and if someone is feeding you a position or opinion they claim to be absolute and from God, then they're always serving their own agenda)
-
No, some are serving their own agenda. Not all. Trusting prophets is a risk in some cases, as some are not trustworthy and some are.
I personally do not accept that youtube vid, i claim it as bs. Yeah u guessed my reaction. But meh, its my first impression.
And yes i know and beleive that some, or most, televangelists are BS. I tend to like watching them cauze i look for all the BS they say. Sometimes they speak truth, sometimes, not so. I know some ppl are bull and are traiend to read ppl.
-
Gents, gents...
As Karajorma has already pointed out, devaluing or arguing religious beliefs is going to go precisely nowhere. You can't argue Faith - at least, not productively. And Charismatic is entitled to his beliefs. He's welcome to interpret whatever he wishes into a situation.
This tangent was more about scientific fact, which by nature can't be contradicted by something like Faith (empiricism vs rationalism, anyone? :P). The goal here is to educate Charismatic and whomever else as to what evolution is and what it means, so that he can understand that accepting a highly relevant and legitimate theory does not call for the rejection of Faith.
This is something that really annoys me. There IS NO evolution/creation debate. It's not a debate. Evolution is a solid theory. Creationism is a Faith-based interpretation of the world. The two can be compatible. Understanding in science does not reject belief in Faith. Unfortunately, the Church made it a dichotomous debate in the late 1800s. While most serious scientists have now escaped this mode of debate (and also most theologians), it has left remnants of the population who do not truly understand evolution or their Faith who are insistent on their belief that it must be one or the other. This is precisely what led to all that nonsense in schools in the southern US. It's not people who are educated on the subject with the problem - it's people who read a few radical statements and catch a few buzzwords, then think they're experts.
Arguing against Creationism by arguing against Faith is a ridiculous course of action. Rather, provide the evidence for evolution, and address its problems in order to convey understanding.
Again, anyone who completely disregards evolutionary theory does not truly understand it.
Here's a checklist:
1. Do you believe in cancer? (as an example of mutation)
2. Do you belief that offspring are not identical to their parents?
3. Do you believe that some traits are good in an organism, and some can be bad (example: For people, is it good for your survival to have a defective immune system, or is it bad?)
4. Do you believe that heredity and biological makeup is encoded on a genetic basis in DNA?
If you answered yes to all of the above, congratulations, you believe in evolution by natural selection. It really can be just that simple.
-
I seem to have some vague recollection about how there weren't supposed to be any more prophets after Jesus, but I'm hardly a religious scholar, so someone look that up for me.
-
This is something that really annoys me. There IS NO evolution/creation debate. It's not a debate. Evolution is a solid theory. Creationism is a Faith-based interpretation of the world. The two can be compatible.
I wholeheartedly agree with the above statement... and I'm also a firm believer in the Christian faith.
Evolution (or more specifically, the basic theory therein) is not contradictory to faith. Some of the finer points of the evolutionist attitude I may not agree with (such as humans supposedly evolving from apes), but the basic theory is perfectly compatible.
-
I seem to have some vague recollection about how there weren't supposed to be any more prophets after Jesus, but I'm hardly a religious scholar, so someone look that up for me.
1 Corinthians 14:5 (http://www.biblegateway.com/passage/?search=1%20Corinthians%2014:5;&version=31;)
I would like every one of you to speak in tongues, but I would rather have you prophesy. He who prophesies is greater than one who speaks in tongues, unless he interprets, so that the church may be edified.
-
ah, alright never mind then.
-
I dont trust translations. Im taking a course on (sections of) the bible now, and learning a lot about much of it. King James edition, for example, is using language 400 years olf, that no longer makes sense anyways.
-
well is that wrong? are we still supposed to run into prophets today?
-
This is probably the most popular, or maybe infamous, thread I've ever posted. I'm not sure whether to be proud of myself, or what.
For the record, I'm agnostic(born and raised Catholic) and obviously a believer in evolution.
-
Am I the only one who heard alarm bells ringing when the word "prophet" appeared in this thread?
-
well is that wrong? are we still supposed to run into prophets today?
Who's to say we don't? These days we lock those people away in mental assylums.
-
well... according to the bible, can there still be prophets? (y/n)
-
No, some are serving their own agenda. Not all. Trusting prophets is a risk in some cases, as some are not trustworthy and some are.
I personally do not accept that youtube vid, i claim it as bs. Yeah u guessed my reaction. But meh, its my first impression.
And yes i know and beleive that some, or most, televangelists are BS. I tend to like watching them cauze i look for all the BS they say. Sometimes they speak truth, sometimes, not so. I know some ppl are bull and are traiend to read ppl.
Perhaps my point wasn't clear; it was late, after all.
Your creationist position seems to entirely be based upon the unquestioning belief of one person, or theology, without questioning the basis behind that. Now, that might be fine from a religious-worship point of view, but when questioning the observations made by not just one scientist but the entire scientific community I think you have to also question those you feed you these positions. Because I've seen things in these evolution debates where people have posted 'facts' for creationism that simply are lies. Not wrong, not misunderstood, but deliberate lies told to them from a position of (religious, sometimes posited as scientific) authority.
The fact that you immediately look at something challenging your pespective and go 'bs' without any apparent consideration or thought, make me greatly worried. How - or why - can you go through life with such an uncritical, unreasonable (in the very literal sense of 'reason') attitude? Until you are capable of actively considering things - which does not mean rejecting your faith - with an open mind, you'll be stuck in a dogmatic attitude that I think effectively holds you back.
-
Arguing against Creationism by arguing against Faith is a ridiculous course of action. Rather, provide the evidence for evolution, and address its problems in order to convey understanding.
Actually that's precisely the wrong course of action in this sort of debate. Attempting to defend evolution is the wrong way to go about things. Evolution does not need to be supported in this kind of debate. Evolution is accepted scientific fact. Debating about it as if there was any alternative gives the nonsense spouted by Young-Earth Creationists legitamacy. The favourite comment of YECs is to claim that evolution is a hotly debated subject. Of course they never point out that only YECs are still debating the issue because everyone else has moved on.
So do not explain why evolution is right. Explain why creationism is wrong. Make them defend their ridiculous half-baked notions of what science is and you'll soon expose them as frauds, kooks or completely ignorant. Extraordinary claims require extraordinary proof. Make them try to prove it.
I wholeheartedly agree with the above statement... and I'm also a firm believer in the Christian faith.
Evolution (or more specifically, the basic theory therein) is not contradictory to faith. Some of the finer points of the evolutionist attitude I may not agree with (such as humans supposedly evolving from apes), but the basic theory is perfectly compatible.
Alright. I'll bite.
First there is no such thing as an evolutionist. It's a name made up creationists to attempt to pigeon-hole their opponents into a niche that doesn't exist. Either you accept science or you don't. Calling someone an evolutionist because they accept evolution as fact is about as sensible as calling them sphere-Earthers because they don't believe the world is flat.
Second if you don't accept that humans came from apes then you are not just missing a finer point of evolutionary theory as you wanted to put it. You're missing the entire point. Unless you can come up with a credible explaination for where humans did come from that explains all the similarities we have to chimps and the other great apes your point of view is actually even more incomprehensible than Charismatic's.
Why would evolution get as far as the great apes and then suddenly cut off? Why is fossil record proof of evolution acceptable up until six million years ago and then suddenly suspect? Why do chimps share 99% of our DNA? How come Neanderthals could use tools far more complex than anything except those used by humans (and maybe even musical instuments)?
-
Of course they never point out that only YECs are still debating the issue because everyone else has moved on.
Eh, explain people like Dawkins then. He hasn't moved on; he's nearly an evolutionary evangelist.
Why do chimps share 99% of our DNA?
DNA is an instruction manual, not a template. Constructing a cell requires a massive amount of information because you're making the fundamental building blocks of an organism. Going from cells to tissues takes less information but is still very complicated. Then you've got to get from tissue to organs, and from organs to systems. Once you have a whole bunch of systems to use, it takes comparatively far less information to differentiate between animals. Once you've gotten from mammals to primates, you require a lot less incremental information. So the 1% difference isn't that surprising. It took about a billion years to go from prokaryotes to eukaryotes, after all, and that's about 25% of the length of time life has been around.
Am I the only one who heard alarm bells ringing when the word "prophet" appeared in this thread?
Nope.
1 John 4:1 (http://www.biblegateway.com/passage/?search=1%20John%204:1;&version=31;)
Dear friends, do not believe every spirit, but test the spirits to see whether they are from God, because many false prophets have gone out into the world.
(emphasis mine)
Nevertheless, true prophets do indeed exist.
-
Eh, explain people like Dawkins then. He hasn't moved on; he's nearly an evolutionary evangelist.
Not really. Dawkins main goal is point out that God doesn't exist. Not to prove that evolution is correct. Even if tomorrow every YEC suddenly realised that they were wrong I doubt that would stop him from writing books about evolution (Something he does very well) or trying to point out that there is no good reason to believe God exists.
And for that matter I happen to think that Dawkins takes the completely wrong track because although he's 100% correct his tactlessness is partially responsible for the fact that certain people can't tell the difference between evolution and atheism. Which makes my job of explaining it much harder. Of course he's not completely to blame. The fact that someone like Charismatic could have it explained to him about 40 times that no one is saying that accepting evolution doesn't mean you have to give up believing in God and still not get it does show you what you're dealing with.
Why do chimps share 99% of our DNA?
DNA is an instruction manual, not a template. Constructing a cell requires a massive amount of information because you're making the fundamental building blocks of an organism. Going from cells to tissues takes less information but is still very complicated. Then you've got to get from tissue to organs, and from organs to systems. Once you have a whole bunch of systems to use, it takes comparatively far less information to differentiate between animals. Once you've gotten from mammals to primates, you require a lot less incremental information. So the 1% difference isn't that surprising. It took about a billion years to go from prokaryotes to eukaryotes, after all, and that's about 25% of the length of time life has been around.
You appear to be making the assumption that there is only one way to do a task and that's not true.
Suppose I gave two programmers the task of building an application. One has the code for a very similar application and the other one is starting from scratch. Do you really think that the two apps would be identical once finished? Or do you think that the application built using the code from the first would have vast portions completely untouched while the one programmed from scratch would have found a completely different way to handle the task?
Now look for bits of code that are commented out. You'll find that they are almost identical because there was no real reason for the coder who was upgrading the old program to touch them at all.
The same is true in human vs chimp comparisons. The DNA is the same even when there are other proteins that could do the same task. You haven't considered that large portions of DNA in both humans and chimps don't even code any proteins. They don't do anything at all. They're just along for the ride. And if you compare these against chimp DNA which also does nothing you'll find no more variation than you'd expect from a few million years of random mutation and other environmental changes.
So even if you deny that humans evolved from the same ancestor as the chimp you're saying that when God created humanity he fiddled with their DNA until it looked exactly the same as it would if they had. Even going so far as to go in and add all the non-coding DNA that wouldn't do anything even though there was no need to do this whatsoever.
-
Of course they never point out that only YECs are still debating the issue because everyone else has moved on.
Eh, explain people like Dawkins then. He hasn't moved on; he's nearly an evolutionary evangelist.
No, Dawkins is an aetheist evangelist and a biologist. There's a difference; but it's understandable not to see it when much of his career has had to defending his field it from attacks formed solely upon deliberate, religious motivated, lies. Have you read any of Dawkins' biology work? If he evangelises anything, IMO it's the incredible complexity of life and nature. Evolution is simply the method for explaining that.
-
To be perfectly fair, I find Dawkins' "atheist evangelism" slightly irritating. There are so many people trotting around now who think they're so clever because they can shoot down ontological arguments, and apparently nobody's bothered to tell them that it's been so long since Kant and Hume tore everybody a new one that philosophers don't even care about god anymore.
-
To be perfectly fair, I find Dawkins' "atheist evangelism" slightly irritating. There are so many people trotting around now who think they're so clever because they can shoot down ontological arguments, and apparently nobody's bothered to tell them that it's been so long since Kant and Hume tore everybody a new one that philosophers don't even care about god anymore.
I have to admit agreeing on that; Dawkins simply doesn't need to do things like The God Delusion (although I think it's still useful to do so, especially as it's a viewpoint rarely espoused on TV*). He's an excellent scientific writer and just conveying the facts is an effective way of 'evangelising' evolution (in the same sense as looking at grass is your eyes 'evangelising' that it's green).
*Dawkins did a 2-episode TV series to correspond to the book on Channel 4, which was followed IIRC by a 'rebuttal' programme.
-
I consider myself a Christian and I have no trouble accepting evolution as the more logical and provable explanation.
Sorry, but I think organized religion is very very bad. The Bible was written by flawed men thousands of years ago with a flawed message and many inconsistencies. Plus the Vatican (The Catholics) sin against God every single day, so that leaves them out as well.
Now can it not be true that "GOD" created evolution? The Bible was written by men who had not the understanding of what they were actually trying to write about except in the most fundamental and often miscommunicated way.
When they say the Earth was created in 6 days could it not actually be 6 billion years? What is a day to God? Do you know? Of course you don't.
I had been watching a TV evangelist off and on lately and it was fine until he started spouting off how the geological record was false cause of the Flood. I was like WTF? "carbon 14 dating is off cause of water and volcanic eruption etc.." I turned my tv off...
He claimed Humanity has only existed like 10-20 thousand years. I was like MF what about LUCY in Africa isn't she like 4 million years old??? If God can't explain her you need to get the hell out of my living room! :D
It's nice people believe in God, but not to the point of stupidity when facts that are pretty much indisputable are staring you in the face. Denial does no impress me or sway me to their opinion. In fact it simply makes them look retarded to me.
God made me in his image says the Bible. That may be 100% true but not as we think of the process. Every day Humanity learns more and is capable of more affecting ourselves and our environment. If this progresses maybe if we are lucky it will grow to encompass our solar system or even galaxy.
Then consider as we make these leaps we are also changing and growing is that NOT evolution. Are we not becoming more and more like God? IS this NOT God's plan? We not only are in the image of God we also have been given these abilities and growth BY God to become more like him. If we weren't supposed to become more than we once were the any sort of diety would never bother to create us.
Either a.) we were purposefully created with our creator's foreknowledge that we WOULD evolve and grow. Thus God is the Ultimate Scientist (This I'd like to believe)
or b.) We are a Mistake or Happy Accident by random factors in the Universe and GOD was not involved, we invented him or his involvement.
And you know what? Odds are this is 50/50 but that's where faith comes in and I choose letter A Monty... :D
EVOLUTION FTW!!!
And BTW animals have language, that's why they make noises (it's called vocal communication, try it sometime.)
Piss off your pet next time and see what noise they make (be it a growl, harsh chirp, or whatever...) They're trying to tell you THAT THEY ARE ANGRY!!! (mumbles) Morons...
-
The reason religious people tend to object to evolution is that evolution shows that we don't need God to explain life on earth.
-
Well given that "Where do we come from?" has been their major hook for centuries it's hardly surprising.
Pity they don't realise that it's not a question for them in the first place. "Why are we here?" is more of a question for religions to attempt to answer. They only got "Where do we come from?" because till a couple of hundred years ago no one else had an answer.
-
The same is true in human vs chimp comparisons. The DNA is the same even when there are other proteins that could do the same task. You haven't considered that large portions of DNA in both humans and chimps don't even code any proteins. They don't do anything at all. They're just along for the ride. And if you compare these against chimp DNA which also does nothing you'll find no more variation than you'd expect from a few million years of random mutation and other environmental changes.
It's time for a genetics lesson! (Not that I'm contradicting you, karajorma, just figured this could use some elaboration).
A lot of people don't understand the molecular mechanisms behind evolution, so here's a summarized lecture of a 400-level evo-devo class for free =)
The central dogma of molecular biology is that DNA is transcribed to RNA, which is translated into protein. Proteins are the workers of the cell: as enzymes, as ion channels, as linkers, as identifiers, and in dozens of other functions, proteins make life work.
At least, that's what we USED to think.
Turns out RNA can be reverse transcripted into DNA. RNA can also act as an enzyme - it can be a worker in the same capacity as protein. RNA can also act as an enzyme on itself, performing editing and self-cleavage functions. In some bacteria, RNA does as much work as proteins. In fact, a well-accepted hypothesis is that RNA actually existed before DNA or protein functions. DNA is more stable than RNA, so it has evolved as information storage. Proteins are more robust than RNA, so they function better as enzymes.
But, we've still got a problem in that RNA has kept these enzymatic functions - we see them in all forms of life. So why, if better mechanisms have evolved, does RNA still maintain these functions?
Two reasons: 1. because they work. 2. Flexibility.
People often cite that humans and chimps are 99% identical. That figure is actually misleading. Humans and chimps are 99% identical at the base-pair (code level). At the expression level, we're very different. For a long time humans were perplexed why some creatures have upwards of 150,000 protein-coding regions, yet humans only have between 35 and 45 thousand. The answer is RNA editing. We express millions (if not billions) of proteins, but we do it through complex regulation encoded in the "junk" DNA in our cell. RNA is instructed to self-edit. Thus, one coding fragment can produce a thousand different proteins.
Someone is probably asking what this has to do with chimps and humans and evolution.
Evolution is the great miser, traditionally. Whatever works, it keeps, and whatever doesn't, dies. But this isn't actually entirely true at the DNA level.
DNA doesn't have a perfect copying mechanism - far from it. Cells don't have backups (even the pairing scheme doesn't constitute a full backup for a variety of reason much too complex to explain here). So DNA frequently gets long "junk" regions that don't mean anything stuck in it, or long regions deleted. These regions are the mechanism of evolution on the molecular scale. Contrary to popular belief that mutation of protein-coding regions is what causes evolution, it's actually DNA modification in junk regions that drives evolution. Example:
Between the gene ALPHA1 and the gene BETA1 there could be a stretch of bases that runs GCTACAAAATTTTAAAATTTTAAAATTTTCG
Codons (triplets of bases) code for amino acids (protein building blocks). So, we have GCT-ACA-AAA-TTT-etc But this doesn't mean anything. It's junk DNA - it has no regulator, it has no start codon, it's got nothing. It has no function. But delete the first two bases (a common occurrence). Now the first codon is TAC. In RNA, that's AUG - the codon that signals for methionine, the start sequence of all protein translation. Suddenly, a region that COULD code for a protein is between two actual genes. What happens if one of those genes gets deleted, or misfunctions? It's regulatory region begins to act on the first available coding sequence. Suddenly we have a previously unknown protein appearing. This might be beneficial, or it might kill the organism. That's natural selection.
This is only one example. DNA breaks, re-aligns, deletes, adds bases, changes bases, adds regions, combines chromosomes, and generally acts in a way that's anything BUT completely stable. But if it was completely stable, nothing would evolve.
It's actually remarkable that any species DOES resemble another - and this is the basis on which we generate evolutionary trees. Complex algorithms are used to compare all regions, not just coding regions. What we find is that we can actually trace, at the molecular level, changes between organisms. Now, we can't estimate exactly what happened between species (there are approximately 3 billion base-pairs in human DNA, and we have a SMALL genome). 1% of 3 billion is 30 million base-pairs. Considering the average gene, including coding and regulatory regions, is only a few thousand base pairs, there's a lot of variation in 1%. Of course, most of that is regulatory regions and unknown elements that appear in "junk" DNA. In reality, while estimates for junk DNA in the cell usually fit somewhere about 50% of the total genome, that figure is probably much, much lower. We have nothing more than a basic grasp of how the human genome works.
So now that you know the details behind the mechanism, consider this: why is code conserved between humans and mice? Between humans and fungi? Betweens humans and protozoans? Betweens humans and reptiles? (I'm not touching bacteria here because there's an alternative explanation other than evolution). Obviously these regions are essential for life. And we can see how variation has occurred over time. Molecular genetics illustrates the variation that occurs at the DNA level between organismsms, which ultimately demonstrates how remarkably DIFFERENT all species are, yet also how remarkably similar. It's clear that humans are related to primates. It's clear that we're related to other mammals. And it's clear that species do change over time - there are genetic differences even between our ancestors 10,000 years ago and modern humans.
But, we're not a product of just our genes - our genes are a product of our environment. Environment favours certain types of gene expression, and rejects others. The driving force behind evolution is not genetic change - it's environmental change. Genetic plasticity is merely the mechanism by which it occurs. Even then, congenital and developmental defects are not always driven by changes at a genetic coding level - rather, gene expression is variable, and environment is what determines gene expression (and I'm referring to environment in the sense of anything surrounding DNA, including protein, lipid, other cells, viruses, bacteria, pathogenic host cells, dirt, metal ions, cellular-interactions, and everything right on up to the elephant that steps on your big toe). Thus, species occupy niches determined by a combination of their genes and the environment in which they develop.
Really, the only problem evolution poses for Creationists is thus: First, the age of the Earth. Second, the fact that life changes over time, rather than remaining static. Creationism is a plausible metaphor for understanding how life changes to occupy niches in a simplistic understanding. Evolution is how this occurs in an observable way.
But this brings up another bit of food for thought: Anyone who can look at DNA and think evolution is purely "random" is missing the big picture. A combination of genetic plasticity, developmental plasticity, and environmental plasticity drive evolution. Thus evolution is actually directed by the forces of Nature, the laws of physics. If you want to define those forces and laws as "God in the details" you're welcome to. There is an elegance to life and natural laws that science cannot, and never will be able to fully explain. This is why humans have developed and (I argue) actually need some form of Faith (which may not be religious Faith, mind you). It is just necessary to remember that Faith should accomodate understanding, not oppose it.
Hope this made sense. If anyone has further questions, I have a shorter discussion on why many higher organisms look identical at a certain stage of development that illustrates this further, and perhaps a little more simplistically.
-
ok i read, most of what chatter involved my side of this discussion. I skipped some crap about darwin or w\e, sorry. Im tired and am almost not arsed to reply just yet, but here it goes.
BTW i forgot to ask my dad again, but it will happen.
Ryan, you call that brief? LOL.
EDIT: Crap, thought u said 'brief lesson'. My bad.
This is something that really annoys me. There IS NO evolution/creation debate. It's not a debate. Evolution is a solid theory. Creationism is a Faith-based interpretation of the world. The two can be compatible.
I wholeheartedly agree with the above statement... and I'm also a firm believer in the Christian faith.
Evolution (or more specifically, the basic theory therein) is not contradictory to faith. Some of the finer points of the evolutionist attitude I may not agree with (such as humans supposedly evolving from apes), but the basic theory is perfectly compatible.
I am sorry but I do not believe, one can be a 'true' Christian, so to speak, and still beleive in Evolution. You claim you 'beleive' in god, yet, you subscribe to Evolution to 'explain things in facts'. I just dont see how that works. God tells us how things went down. God did not say man evolved by mutation. I dont feel like getting into this one that deep. But, i do think that the beleive you can go dual beleifs is a lie, twisting the facts to make you think you can do both. You cant walk down two roads at once, so to speak. And please, no witty comments about highways or whatever please.
*SNIP*
1 Corinthians 14:5 (http://www.biblegateway.com/passage/?search=1%20Corinthians%2014:5;&version=31;)
I would like every one of you to speak in tongues, but I would rather have you prophesy. He who prophesies is greater than one who speaks in tongues, unless he interprets, so that the church may be edified.
Yes that is true, and i do not see any incorrect transilations. Do you all understand what this scripture is saying, or shall i explain it? I actualy think you guys will say 'i understand it' when you really dont.
I dont trust translations. Im taking a course on (sections of) the bible now, and learning a lot about much of it. King James edition, for example, is using language 400 years olf, that no longer makes sense anyways.
My Favorite version, and the one i hold true to, is the KJV. The new KJV is fine, but the KJV makes sences, tho its alittle hard to read. I figure it has been transilated less times and is correct. Alot of the new bibles are comeing out with ****ed up meanings, like; it meant one thing, but they made it sound to mean another in the new version.
well is that wrong? are we still supposed to run into prophets today?
Yes we are, no its not wrong.
Am I the only one who heard alarm bells ringing when the word "prophet" appeared in this thread?
I knew it would get your guys attention. The prophets name is Owen Johnson (sp?). His son died in a accident a while back, and had some.. place, named after him.
well... according to the bible, can there still be prophets? (y/n)
Y.
No, some are serving their own agenda. Not all. Trusting prophets is a risk in some cases, as some are not trustworthy and some are.
I personally do not accept that youtube vid, i claim it as bs. Yeah u guessed my reaction. But meh, its my first impression.
And yes i know and beleive that some, or most, televangelists are BS. I tend to like watching them cauze i look for all the BS they say. Sometimes they speak truth, sometimes, not so. I know some ppl are bull and are traiend to read ppl.
Perhaps my point wasn't clear; it was late, after all.
Your creationist position seems to entirely be based upon the unquestioning belief of one person, or theology, without questioning the basis behind that. Now, that might be fine from a religious-worship point of view, but when questioning the observations made by not just one scientist but the entire scientific community I think you have to also question those you feed you these positions. Because I've seen things in these evolution debates where people have posted 'facts' for creationism that simply are lies. Not wrong, not misunderstood, but deliberate lies told to them from a position of (religious, sometimes posited as scientific) authority.
The fact that you immediately look at something challenging your pespective and go 'bs' without any apparent consideration or thought, make me greatly worried. How - or why - can you go through life with such an uncritical, unreasonable (in the very literal sense of 'reason') attitude? Until you are capable of actively considering things - which does not mean rejecting your faith - with an open mind, you'll be stuck in a dogmatic attitude that I think effectively holds you back.
Are you saying i have spit out lies in this thread, or the last one?
And yes, i am able, and i do fully conciter things. I am capable to look at all angles of debates and situations. I am not blind and i do not shut out every view that disagrees with me, and label it bull****. I am not a child.
Am I the only one who heard alarm bells ringing when the word "prophet" appeared in this thread?
Nope.
1 John 4:1 (http://www.biblegateway.com/passage/?search=1%20John%204:1;&version=31;)
Dear friends, do not believe every spirit, but test the spirits to see whether they are from God, because many false prophets have gone out into the world.
(emphasis mine)
Nevertheless, true prophets do indeed exist.
What alamrs went off when i said prophet?
And do you guys know what This passage means either? You guys quote scripture and know not what it means.I consider myself a Christian and I have no trouble accepting evolution as the more logical and provable explanation.
A less confuzing more down-to-earth explination, yes. But how can you pick and choose what parts of the bible to beleive?
Sorry, but I think organized religion is very very bad. The Bible was written by flawed men thousands of years ago with a flawed message and many inconsistencies. Plus the Vatican (The Catholics) sin against God every single day, so that leaves them out as well.
And how do you know those men were flawd? How can you possibly prove that? How do they have a flawd message? Have you read nothing in the bible? And people sin, Vaticans sin, everyone sins. Thats why we can ask God for forgiveness. Does that mean, that everyone who sins, does not believe in god? NO. Your logic is worse then mine, and im surpirzed no one else sees this.
Now can it not be true that "GOD" created evolution? The Bible was written by men who had not the understanding of what they were actually trying to write about except in the most fundamental and often miscommunicated way.
Have you ever heard the term 'led by the spirit'. Miscommunicated way? Fine, what were tehy really trying to tell us? Let me guess. its something Different then what they ACTUALLY DID TELL US. How convenient. And you are also flawd. God showed Peter, in a vision, what the **** he was susposed to write down, and he DID. Read Revelation. Plus there are other parts in the bible where god told\showed people what to write down. So they did not need to understand, but God mostlikely showed them what He meant anyways.
When they say the Earth was created in 6 days could it not actually be 6 billion years? What is a day to God? Do you know? Of course you don't.
Lol this is one of the first things you guys try to trip us up on. Well think about it. He created the sun right? I believe 6 days is 6 24 hour days. Its easy to tell its not (365*1billion) sunrieses. We can tell when the next day comes, in morning.
I had been watching a TV evangelist off and on lately and it was fine until he started spouting off how the geological record was false cause of the Flood. I was like WTF? "carbon 14 dating is off cause of water and volcanic eruption etc.." I turned my tv off...
Dont trust all of them to be correct. Read Sandwiches quote.
He claimed Humanity has only existed like 10-20 thousand years. I was like MF what about LUCY in Africa isn't she like 4 million years old??? If God can't explain her you need to get the hell out of my living room! :D
Yeah i agree with him, about 10-20K years. Who says God cant explain 'her'.
It's nice people believe in God, but not to the point of stupidity when facts that are pretty much indisputable are staring you in the face. Denial does no impress me or sway me to their opinion. In fact it simply makes them look retarded to me.
How can you just beleive in god, and then go and believe in Evolution to explain things?
God made me in his image says the Bible. That may be 100% true but not as we think of the process. Every day Humanity learns more and is capable of more affecting ourselves and our environment. If this progresses maybe if we are lucky it will grow to encompass our solar system or even galaxy.
The process of face-lifts and plastic surgury? Um...
Then consider as we make these leaps we are also changing and growing is that NOT evolution. Are we not becoming more and more like God? IS this NOT God's plan? We not only are in the image of God we also have been given these abilities and growth BY God to become more like him. If we weren't supposed to become more than we once were the any sort of diety would never bother to create us.
Well define evolution. But we have not spanded the galixy yet. Do you claim you know gods plan? Lol. Look and abilities are different ,ol yeller. You may get a facelift and look like me, but i would still beat your ass in a fight, or a race, or anything else. So you claim, if you get a body-lift (whatever) to look like Arnold, you can pick up cars, and do amazing thigns? Lol. Nice claim.
Either a.) we were purposefully created with our creator's foreknowledge that we WOULD evolve and grow. Thus God is the Ultimate Scientist (This I'd like to believe)
Lol. So hes a scientist now? HAHA.
or b.) We are a Mistake or Happy Accident by random factors in the Universe and GOD was not involved, we invented him or his involvement.
So god can make mistakes, mess up, and not know the consiquencs.
And you know what? Odds are this is 50/50 but that's where faith comes in and I choose letter A Monty... :D
EVOLUTION FTW!!!
And BTW animals have language, that's why they make noises (it's called vocal communication, try it sometime.)
Piss off your pet next time and see what noise they make (be it a growl, harsh chirp, or whatever...) They're trying to tell you THAT THEY ARE ANGRY!!! (mumbles) Morons..
-
You can not believe in the bible and evolution, I know a lot about both (I am not saying that I know more about evolution, just a lot. (I did take college biology for a year). I am saying that I know more about the bible though).
I hate it when people try to marry 2 apposing things just so that everyone can be "right".
Note: I am not going to say which one I believe in.
-
You appear to be making the assumption that there is only one way to do a task
No, I'm not. If humans are based on chimps, all you need to do to get a human from a chimp is to take chimp DNA and tweak a few things. The code to lay the foundation of cells, tissues, and organs is already present and working and doesn't need to be messed with. This is true whether the agent of change is God or evolution.
The point I was trying to make is that one percent is not necessarily an indicator of how similar animals are. Evolution has been exponential, not constant. You may as well say that because it took 10,000 years to get from the wheel to the locomotive, but only 200 to get from the locomotive to the maglev, that the maglev is only 2% different from the locomotive.
EDIT: I see that MP-Ryan said the same thing, only a lot more thoroughly. :)
Incidentally, I've been inclined lately to plead "no contest" to evolution. Augustine warned about applying science to theology back in the 400s. :)
Usually, even a non-Christian knows something about the earth, the heavens, and the other elements of this world, about the motion and orbit of the stars and even their size and relative positions, about the predictable eclipses of the sun and moon, the cycles of the years and the seasons, about the kinds of animals, shrubs, stones, and so forth, and this knowledge he hold to as being certain from reason and experience. Now, it is a disgraceful and dangerous thing for an infidel to hear a Christian, presumably giving the meaning of Holy Scripture, talking nonsense on these topics; and we should take all means to prevent such an embarrassing situation, in which people show up vast ignorance in a Christian and laugh it to scorn.
The shame is not so much that an ignorant individual is derided, but that people outside the household of faith think our sacred writers held such opinions, and, to the great loss of those for whose salvation we toil, the writers of our Scripture are criticized and rejected as unlearned men. If they find a Christian mistaken in a field which they themselves know well and hear him maintaining his foolish opinions about our books, how are they going to believe those books in matters concerning the resurrection of the dead, the hope of eternal life, and the kingdom of heaven, when they think their pages are full of falsehoods and on facts which they themselves have learnt from experience and the light of reason? Reckless and incompetent expounders of Holy Scripture bring untold trouble and sorrow on their wiser brethren when they are caught in one of their mischievous false opinions and are taken to task by those who are not bound by the authority of our sacred books. For then, to defend their utterly foolish and obviously untrue statements, they will try to call upon Holy Scripture for proof and even recite from memory many passages which they think support their position, although they understand neither what they say nor the things about which they make assertion.
-
Are you saying i have spit out lies in this thread, or the last one?
And yes, i am able, and i do fully conciter things. I am capable to look at all angles of debates and situations. I am not blind and i do not shut out every view that disagrees with me, and label it bull****. I am not a child.
If you have repeated creationist / intelligent design dogma, I'm afraid so. The standard ID/creationist tactic is to discredit evidenced science by lying about the evidence being present. It's entirely understandable, if you only get given one side of the story.
But I would question either your desire to consider opposing evidence or correctly weigh it if you still believe evolution is anything other than scientific 'fact' (in the same sense as gravity being scientific 'fact'), given your participation in prior threads.
This quote;
I am sorry but I do not believe, one can be a 'true' Christian, so to speak, and still beleive in Evolution. You claim you 'beleive' in god, yet, you subscribe to Evolution to 'explain things in facts'. I just dont see how that works. God tells us how things went down. God did not say man evolved by mutation. I dont feel like getting into this one that deep. But, i do think that the beleive you can go dual beleifs is a lie, twisting the facts to make you think you can do both. You cant walk down two roads at once, so to speak. And please, no witty comments about highways or whatever please.
is pretty strong evidence for me of a dogmatic, blind view. Especially given that most major denominations of christianity are happy to recognise evolution as valid - because the alternative would be admitting that the obervable world and centuries of scientific endeavour have voided the concept of life directly created by God. Essentially, justifying creationism means you have to say every single scientific discovery since the 19th century (and probably before) is wrong. THat includes the science allowing you to type on this forum, and the science that allows doctors to, say, stitch you back up after a car crash.
Or do you believe that the earth is flat, 5,000 years old and was made in 6 days?
-
No, I'm not. If humans are based on chimps, all you need to do to get a human from a chimp is to take chimp DNA and tweak a few things. The code to lay the foundation of cells, tissues, and organs is already present and working and doesn't need to be messed with. This is true whether the agent of change is God or evolution.
So in other words you're saying that the reason why the human and the chimp are similar is because God took a chimp (or similar) and fiddled with it until he had a human?
If that is true what the hell are Homo Habilis, Homo Neanderthalis and all the rest? The reject pile?
Unless you can come up with a credible explaination for where humans did come from that explains all the similarities we have to chimps and the other great apes your point of view is actually even more incomprehensible than Charismatic's.
Notice the word all? You can explain any one point but it's when you try explaining all of them together that you run into problems. The only way you can explain the 99% similarity between chimps and humans is to say that God took a look at the DNA of the chimp (or it's ancestor) and used that as a template for humanity. But then you've dug a bigger hole for yourself explaining what the other Hominids were.
-
Everyone can believe what they want or what they "feel" is right. Well in the USA anyway.
As for me, I think it's pretty fricken simple and men got into power and let say they "compicated things" and according to God Jesus was THE final word (He became savior and HIS message overrode all others the old covenants became null and void so so much for scriptures, sorry Isaac and Abraham and all that crowd...) Plus that whole purgatory thing proves the A.) God CAN mess up (so much for almighty, better take that off the banner, and B.) He CAN change his mind.
"Banished to Purgatory for Eternity... Whoops Never mind I sent Jesus to Purgatory to get everyone out, now you just go to Heaven or Hell, yeah that's it..."
I thought For Eternity meant forever (or until the end of space and time)... But then again I'm an imperfect being judging something that seems imperfect to begin with. Maybe there's some level no one on Earth is able to grasp it and explain it to the rest of it cause every time they open their mouths I can poke a stick right through it... Maybe I'M DIVINE? (which of course we ALL are accordign to the bible...) What an oxymoron we are DIVINE SINNERS!!! (Quote for truth)...
You know if you think about it Too Much it can really make your head hurt!
As for that DNA explanation that made my head hurt, I managed to make out Gattatica and that was it (which was a kickass film BTW)... :D
I really hope that someday we can survive just long enough before our sun goes boom in around 4 billion years to find any sort of sentient life out there...
Us moderates will be fine with it and overjoyed to discover another of "God's children", while the fundamentalists get critically bent out of shape as this would completely destroy their complete reliance on "scripture" :D (Mass suicides and riots to follow)...
Alien Overlord viewpoint: "WTF is up with them?"
Alien Overlord's XO: "Dunno... So what do you think, Orbital Bombardment?"
Alien Overlord: "Cool, lets see if we can get that guy before he gets across that bridge!"
:nervous: Umm lets just hope their friendly...
-
No, I'm not. If humans are based on chimps, all you need to do to get a human from a chimp is to take chimp DNA and tweak a few things. The code to lay the foundation of cells, tissues, and organs is already present and working and doesn't need to be messed with. This is true whether the agent of change is God or evolution.
So in other words you're saying that the reason why the human and the chimp are similar is because God took a chimp (or similar) and fiddled with it until he had a human?
If that is true what the hell are Homo Habilis, Homo Neanderthalis and all the rest? The reject pile?
Not at all. You're deliberately misreading my post. I said if humans are based on chimps, this is what to do to get from one to the other. I'm making no claim to whether one is based on the other or in what order they evolved or any of that. The only thing I'm claiming is that 1% differentiation does not imply as much similarity as one might think, for the simple reason that evolution has historically been exponential, not constant, in advancement.
I notice you haven't addressed MP-Ryan's post at all, btw.
What alamrs went off when i said prophet?
I think people are wary of the charlatans that try to con people out of money, or attract attention to themselves, or fool people via magic tricks and sleight-of-hand. That's what I was referring to when I quoted the verse about "many false prophets".
But just because many false prophets exist does not therefore mean that true prophets don't exist. The important thing is to tell the difference between the two. Most people, unfortunately, have only had experience with the former.
-
But just because many false prophets exist does not therefore mean that true prophets don't exist.
Or not. Believing in a God or whatever is all well and good, but when people start claiming they've met supernaturally powered 'prophets', it's no longer the realm of philosophy but rather the realm of stupidity.
-
So in other words you're saying that the reason why the human and the chimp are similar is because God took a chimp (or similar) and fiddled with it until he had a human?
If that is true what the hell are Homo Habilis, Homo Neanderthalis and all the rest? The reject pile?
Not at all. You're deliberately misreading my post. I said if humans are based on chimps, this is what to do to get from one to the other.
Actually I'm fast approaching the point where I haven't got the faintest clue what you're on about. The misreading isn't deliberate. Hence the question marks. :p Can you explain yourself more clearly please?
I'm making no claim to whether one is based on the other or in what order they evolved or any of that. The only thing I'm claiming is that 1% differentiation does not imply as much similarity as one might think, for the simple reason that evolution has historically been exponential, not constant, in advancement.
First I'm not buying this evolution is exponential stuff if it means what you sound like you're saying. A human is no more evolved than a fish. Humans simply come from a different evolutionary niche than fish do. Yet they've been around more than 100 times longer than we have.
I notice you haven't addressed MP-Ryan's post at all, btw.
Notice that MP-Ryan never said I was wrong. :p You merely claimed that his post supported your argument. I tend to disagree but I'm waiting for him to post his opinions on that.
-
Not at all. You're deliberately misreading my post. I said if humans are based on chimps, this is what to do to get from one to the other. I'm making no claim to whether one is based on the other or in what order they evolved or any of that. The only thing I'm claiming is that 1% differentiation does not imply as much similarity as one might think, for the simple reason that evolution has historically been exponential, not constant, in advancement.
Considering that humans are not based on chimps, instead the fact is that both chimps and humans if you go back far enough share a common ancestor. Which was neither homo or pan.
Also 'advancement' is a false concept when dealing with evolution, as is the claim that it's 'exponential.' Puncutated equilibrium means that there are periods of fast change in tune with drastic changes in the climate. However unilineal evolution where it's 'accelerating' to some prescribed 'perfection/advancement' is a completely flawed idea that reeks of the 19th century and people such as Spencer (who developed Social 'Darwinism').
Organisms adapt to their environment. There's no 'goal' of evolution save for self-propigation. Some species wind up with traits that means there's 6 billion of them.
-
Are you saying i have spit out lies in this thread, or the last one?
And yes, i am able, and i do fully conciter things. I am capable to look at all angles of debates and situations. I am not blind and i do not shut out every view that disagrees with me, and label it bull****. I am not a child.
Yes, you have regurgitated lies told to you.
-
i think we are all pieces to a computer and that mice are the technicians.
oh oh and the meaning of life is 42
-
i think we are all pieces to a computer and that mice are the technicians.
oh oh and the meaning of life is 42
Nope. Not mice; interdimensional beings pretending to be mice.
-
thank you aldo :ick:
-
i think we are all pieces to a computer and that mice are the technicians.
oh oh and the meaning of life is 42
I thought it was 69 :drevil:
-
(http://i22.photobucket.com/albums/b319/Mistah_Kurtz/lmao-real-1.jpg)
-
So in other words you're saying that the reason why the human and the chimp are similar is because God took a chimp (or similar) and fiddled with it until he had a human?
If that is true what the hell are Homo Habilis, Homo Neanderthalis and all the rest? The reject pile?
Not at all. You're deliberately misreading my post. I said if humans are based on chimps, this is what to do to get from one to the other.
Actually I'm fast approaching the point where I haven't got the faintest clue what you're on about. The misreading isn't deliberate. Hence the question marks. :p Can you explain yourself more clearly please?
I'm making no claim to whether one is based on the other or in what order they evolved or any of that. The only thing I'm claiming is that 1% differentiation does not imply as much similarity as one might think, for the simple reason that evolution has historically been exponential, not constant, in advancement.
First I'm not buying this evolution is exponential stuff if it means what you sound like you're saying. A human is no more evolved than a fish. Humans simply come from a different evolutionary niche than fish do. Yet they've been around more than 100 times longer than we have.
I notice you haven't addressed MP-Ryan's post at all, btw.
Notice that MP-Ryan never said I was wrong. :p You merely claimed that his post supported your argument. I tend to disagree but I'm waiting for him to post his opinions on that.
Hell, I knew I shouldn't have re-read this thread... sorry for the bump.
You're both right.
Sort of.
There's a view wandering around out there (which I sincerely hope karajorma isn't espousing.. I don't think he is but I'm not quite sure) that no life is more evolutionarily advanced than any other form of life. Which is incorrect. Similarly, it is also incorrect to say humans are "more evolved" than, say, chimps. Neither is true. Speaking purely in evolutionary terms, all life at a given point in time is equal - each form, if it exists, is as advanced as any other if it survives in its environmental niche. But that's at a point - which isn't measurable, because time is relative (i.e. seconds have no physical basis). Arguably time is perception, but that's philosophy.
Point being is that we can only look at environmental fitness OVER time, in which case it's quite clear that some organisms are more advanced evolutionarily than others - advancement being defined as the increased rate of survival. This is nitpicky, but important. Humans are less evolutionarily advanced than some bacterial strains. Alternatively, we're more evolutionarily advanced than several species of insects.
We're a work in progress.
I notice you're both claiming I support your points. Not true. Rather, your points both reflect portions of a modern genetic understanding (but not its entirety).
My argument is actually a deconstruction of karajorma's - we aren't related because we're similar to chimps, we're related because we're less different than one might expect. It's a fine difference (some might claim there isn't a difference) but its a very important distinction. Similarly, Goober tacked onto my explanation of the 1% difference to say evolution is exponential, which is also only partly true.
The truth of the matter is that molecular biology has an elegant complexity to it. Evolution is change. It doesn't matter how much, or how little. All that matters is survival. And evolutin is directed - the forces which contribute to it obey the laws of Nature. As I already said, if someone wants to read that as "God in the details" there isn't a scientific explanation capable of countering it. Evolution is NOT random. Unfortunately, the only way to explain it to people without a complex understanding of molecular genetics is to lie and say it is. Mutation and environmental changes are random - evolution is not.
-
There's a view wandering around out there (which I sincerely hope karajorma isn't espousing.. I don't think he is but I'm not quite sure) that no life is more evolutionarily advanced than any other form of life. Which is incorrect. Similarly, it is also incorrect to say humans are "more evolved" than, say, chimps. Neither is true. Speaking purely in evolutionary terms, all life at a given point in time is equal - each form, if it exists, is as advanced as any other if it survives in its environmental niche. But that's at a point - which isn't measurable, because time is relative (i.e. seconds have no physical basis). Arguably time is perception, but that's philosophy.
Point being is that we can only look at environmental fitness OVER time, in which case it's quite clear that some organisms are more advanced evolutionarily than others - advancement being defined as the increased rate of survival. This is nitpicky, but important. Humans are less evolutionarily advanced than some bacterial strains. Alternatively, we're more evolutionarily advanced than several species of insects.
No we are not! We are more complicated and, maybe, have a more diverse evolutionary history and may have a wider genome with more variation. However, "advance" is a quality term and beyond our everyday communication has no meaning in evolutionary terms - the only thing that matters is fitness, and that has nothing to do with phenotype itself. We being cladistically "above" our ancestors does not indicate a qualitative supremacy above them - it only says that we are descended from an organism A, that our genotype differs significantly. You are trying to apply quality terms into evolutionary discussion, which is inane.
To prove a point: In what way are we more advanced than our recent ancestor, in objective and provable way?
We're a work in progress.
Of course we are, since the selection pressures that morph our geno- and phenotypes are constantly changing.
I notice you're both claiming I support your points. Not true. Rather, your points both reflect portions of a modern genetic understanding (but not its entirety).
My argument is actually a deconstruction of karajorma's - we aren't related because we're similar to chimps, we're related because we're less different than one might expect. It's a fine difference (some might claim there isn't a difference) but its a very important distinction. Similarly, Goober tacked onto my explanation of the 1% difference to say evolution is exponential, which is also only partly true.
No no no no. We are related because we have similar taxonomical history - we share common ancestor and our morphological forms are more closely related to each other than to other taxons outside this cladistical tree. If you chase this idea far enough you end up with one ancestor to all chordates and so on.
Of course, a percentage of genotype does not in any way indicate similarity or difference in phenotype. 1% difference - or 0.01% difference - can be huge if those different genes code completely different proteins which effect the procreative differences between the populations.
The truth of the matter is that molecular biology has an elegant complexity to it. Evolution is change. It doesn't matter how much, or how little. All that matters is survival. And evolutin is directed - the forces which contribute to it obey the laws of Nature. As I already said, if someone wants to read that as "God in the details" there isn't a scientific explanation capable of countering it. Evolution is NOT random. Unfortunately, the only way to explain it to people without a complex understanding of molecular genetics is to lie and say it is. Mutation and environmental changes are random - evolution is not.
Molecular biology and evolutionary biology are very complex fields of science. The evolution is only directed at fitness - whoever breeds the most, under the specific circumstances, has the most offspring. It's quite simply and very complicated, both at the same time.
-
I notice you're both claiming I support your points.
Nope. I said that I disagreed with Goober's assessment that your posts said I was wrong.
-
Are you saying i have spit out lies in this thread, or the last one?
And yes, i am able, and i do fully conciter things. I am capable to look at all angles of debates and situations. I am not blind and i do not shut out every view that disagrees with me, and label it bull****. I am not a child.
If you have repeated creationist / intelligent design dogma, I'm afraid so. The standard ID/creationist tactic is to discredit evidenced science by lying about the evidence being present. It's entirely understandable, if you only get given one side of the story.
But I would question either your desire to consider opposing evidence or correctly weigh it if you still believe evolution is anything other than scientific 'fact' (in the same sense as gravity being scientific 'fact'), given your participation in prior threads.
This quote;
I am sorry but I do not believe, one can be a 'true' Christian, so to speak, and still beleive in Evolution. You claim you 'beleive' in god, yet, you subscribe to Evolution to 'explain things in facts'. I just dont see how that works. God tells us how things went down. God did not say man evolved by mutation. I dont feel like getting into this one that deep. But, i do think that the beleive you can go dual beleifs is a lie, twisting the facts to make you think you can do both. You cant walk down two roads at once, so to speak. And please, no witty comments about highways or whatever please.
is pretty strong evidence for me of a dogmatic, blind view. Especially given that most major denominations of christianity are happy to recognise evolution as valid - because the alternative would be admitting that the obervable world and centuries of scientific endeavour have voided the concept of life directly created by God. Essentially, justifying creationism means you have to say every single scientific discovery since the 19th century (and probably before) is wrong. THat includes the science allowing you to type on this forum, and the science that allows doctors to, say, stitch you back up after a car crash.
Or do you believe that the earth is flat, 5,000 years old and was made in 6 days?
Most majior denominations? Ok, where is your source of info, where is your proof.
And for the record, i believe earth is 5-10,000 years old, and was made in 6 days. The world is more of a rectangular shape.
And also, to show i did what i said id do, i asked my dad about this. He said he did not really study up on this (yet) and cannot tell me anything offhand, as proof etc. He mentioned several things, a few of them were faith, and god proves himself to each one, his own way. He mentioned other things as well.
-
"i believe earth is 5-10,000 years old, and was made in 6 days. The world is more of a rectangular shape."
ok, the sad thing is I actually am not sure where if anywhere in that statement you were joking. the last bit seems like it should be an obvius joke, but it's not too far off from the first bit which I know many people do belive, and seem in line with what you've said. so, all seriusness, do you beleive the earth
(http://images.google.com/images?q=tbn:oe_Wo7CHCLjMcM:http://antwrp.gsfc.nasa.gov/apod/image/earth_1_apollo17_big.gif)
is anything but roughly shpereical in shape?
-
Filthy lies, fed to you by the liberal, gay-loving, tree-hugging media.
Just take a look at (http://history.sandiego.edu/gen/maps/2000s/2004world.jpg)
See ?!? It's clearly rectangular.
-
that map has to be fake, it says china and europe are on the right, and America is on the left!
-
No, the US ist the large green country on the top right. No ?
-
Most majior denominations? Ok, where is your source of info, where is your proof.
Example:
http://www.google.pt/search?hl=en&q=vatican+evolution&btnG=Search
-
Most majior denominations? Ok, where is your source of info, where is your proof.
And for the record, i believe earth is 5-10,000 years old, and was made in 6 days. The world is more of a rectangular shape.
And also, to show i did what i said id do, i asked my dad about this. He said he did not really study up on this (yet) and cannot tell me anything offhand, as proof etc. He mentioned several things, a few of them were faith, and god proves himself to each one, his own way. He mentioned other things as well.
Your dad? Your dad?! Why don't you try, y'know, looking to learned sources? I mean, ones who have done rational, repeatable experiments on these things?
(the 6-10,000 year old thing is a joke, right? I mean, you don't actually believe that, do you? Because it's very easy to disprove)
-
I can believe that, I've argued with enough people to know it's a sadly common beleife, it's the flat earth one I'm really stumped on.
-
I can believe that, I've argued with enough people to know it's a sadly common beleife, it's the flat earth one I'm really stumped on.
How the **** can anyone in a 21st century, 1st world nation possibly believe the earth is 5000 years old?
-
well you see... God did it.
-
well you see... God did it.
What, God made people stupid?
-
they are the chosen ones...
apparently...
-
What, God made people stupid?
Well they start asking questions if you don't.
-
I can believe that, I've argued with enough people to know it's a sadly common beleife, it's the flat earth one I'm really stumped on.
How the **** can anyone in a 21st century, 1st world nation possibly believe the earth is 5000 years old?
I can easily.
Most majior denominations? Ok, where is your source of info, where is your proof.
And for the record, i believe earth is 5-10,000 years old, and was made in 6 days. The world is more of a rectangular shape.
And also, to show i did what i said id do, i asked my dad about this. He said he did not really study up on this (yet) and cannot tell me anything offhand, as proof etc. He mentioned several things, a few of them were faith, and god proves himself to each one, his own way. He mentioned other things as well.
Your dad? Your dad?! Why don't you try, y'know, looking to learned sources? I mean, ones who have done rational, repeatable experiments on these things?
(the 6-10,000 year old thing is a joke, right? I mean, you don't actually believe that, do you? Because it's very easy to disprove)
Not a joke. I believe it.
well you see... God did it.
Yes.
Most majior denominations? Ok, where is your source of info, where is your proof.
Example:
http://www.google.pt/search?hl=en&q=vatican+evolution&btnG=Search
Every link, sides the first one, does not seem like any concrete proof. You'r using google as concrete infalliable proof?
"i believe earth is 5-10,000 years old, and was made in 6 days. The world is more of a rectangular shape."
ok, the sad thing is I actually am not sure where if anywhere in that statement you were joking. the last bit seems like it should be an obvius joke, but it's not too far off from the first bit which I know many people do belive, and seem in line with what you've said. so, all seriusness, do you beleive the earth
(http://images.google.com/images?q=tbn:oe_Wo7CHCLjMcM:http://antwrp.gsfc.nasa.gov/apod/image/earth_1_apollo17_big.gif)
is anything but roughly shpereical in shape?
Earth is a sphere. The Earth is 6-10k years old. No joke.
-
Most majior denominations? Ok, where is your source of info, where is your proof.
Example:
http://www.google.pt/search?hl=en&q=vatican+evolution&btnG=Search
Every link, sides the first one, does not seem like any concrete proof. You'r using google as concrete infalliable proof?
http://www.vatican.va/roman_curia/congregations/cfaith/cti_documents/rc_con_cfaith_doc_20040723_communion-stewardship_en.html
Happy now? What are you going to answer now? The website of the Vatican doesn't offer concrete proof of the Vatican's opinion on the matter?
-
My God.
At the point that partisans of both ideologies resort to blind affirmations of their creeds and sheeplike adherence to their leaders, debate becomes moot.
This thread, if nothing else, serves to expose just how dogmatic and closed-minded people are. The last few posts have been nothing but clashless repeating of talking-points - not to say that there hasn't been any original thought put into this argument, just that there hasn't been enough.
-my 2 cents
-
How the **** can anyone in a 21st century, 1st world nation possibly believe the earth is 5000 years old?
I can easily.
Your dad? Your dad?! Why don't you try, y'know, looking to learned sources? I mean, ones who have done rational, repeatable experiments on these things?
(the 6-10,000 year old thing is a joke, right? I mean, you don't actually believe that, do you? Because it's very easy to disprove)
Not a joke. I believe it.
How can you possible believe something so comprehensively and easily disprovable? It's like believing the sky is light khaki or the grass is purple.
-
It's like believing the sky is mauve or the grass is purple.
Poor examples. Color is perception-based - it's a psychophysical phenomenon. The color I term "mauve" may appear blue to you, because my brain may interpret light of wavelength 485 nm as "mauve".
A better example may be Newton's Laws, or magnetism, etc. But as I stated in my earlier post, when you have statements like
I can easily [believe that the earth is 5000 years old]
this thread transforms into a gigantic pissing contest, involving everyone from Darwin to the Pope. And nobody wants to see the Pope's wanker.
-
It's like believing the sky is mauve or the grass is purple.
Poor examples. Color is perception-based - it's a psychophysical phenomenon. The color I term "mauve" may appear blue to you, because my brain may interpret light of wavelength 485 nm as "mauve".
But their names will be the same. The sky will always be blue to everyone even if they perceive the color diferently.
-
ok, I'll get this going.
Char why do you think the earth is 5-10k years old?
are you aware of the numerous radiometric dating methods which both collaborate each other's results and point at an earth in the billions of years old, and fall in line with numerus other dateing methods as well?
-
You're aware this isn't going to be a debate, right? It's going to be you making sense and him saying something that doesn't have anything to do with what you said.
-
yes
-
It's like believing the sky is mauve or the grass is purple.
Poor examples. Color is perception-based - it's a psychophysical phenomenon. The color I term "mauve" may appear blue to you, because my brain may interpret light of wavelength 485 nm as "mauve".
your (or my) might interpret the wavelength differently, but it nonetheless stands that you can literally define and measure colours in, for example, RGB values and this measurement is automatable. That's is why they call it colour blindness.
-
And nobody wants to see the Pope's wanker.
A wanker is an unpleasant person, not a slang term for penis.
If you don't believe me, I can ask my dad for proof.
-
And nobody wants to see the Pope's wanker.
A wanker is an unpleasant person, not a slang term for penis.
If you don't believe me, I can ask my dad for proof.
Technically, a wanker is someone who engages in the activity of choking the chicken or, indeed, stroking the swan.
-
Perhaps, dare we infer, holding his sausage hostage.
-
You need to read carefully before replying, Janus. Both my posts.
No we are not! We are more complicated and, maybe, have a more diverse evolutionary history and may have a wider genome with more variation. However, "advance" is a quality term and beyond our everyday communication has no meaning in evolutionary terms - the only thing that matters is fitness, and that has nothing to do with phenotype itself. We being cladistically "above" our ancestors does not indicate a qualitative supremacy above them - it only says that we are descended from an organism A, that our genotype differs significantly. You are trying to apply quality terms into evolutionary discussion, which is inane.
To prove a point: In what way are we more advanced than our recent ancestor, in objective and provable way?
I defined "advancement" as an increased rate of survival, or, greater fitness. Species are constantly fluctuating in fitness - which is why some die, some survive. Hence my discussion about "point" evaluation. Please make an effort to read and understand what I'm getting at before running off. "Qualitative supremacy" as you put it is fitness; we exist, our ancestors don't. Homo sapiens has greater fitness than Australopithecus, to choose an example - otherwise they'd be around today (primate evolution occurs by differentiation and reproductive isolation, as with most species). You're reading advanced in a way other than I defined it in my discussion.
This comes back to the nonsense they teach in high school biology and early college classes about evolution which is overly simplistic at best. All species are not equal in evolutionary terms at any period in time - some are more fit (or more advanced, as I termed it for simplicity's sake) than others. We are more fit (or advanced) than our ancestors.
I'm not saying we're more advanced than some species of insects because we build computers, I'm saying we're more advanced than some spcies of insects because humans live and breed in every place on Earth, while the particular insect species I'm referring to are dying out as their habitat is destroyed. We've adapted - they didn't. We're more advanced - or more fit.
Of course we are, since the selection pressures that morph our geno- and phenotypes are constantly changing.
Which I said. Twice. With examples.
No no no no. We are related because we have similar taxonomical history - we share common ancestor and our morphological forms are more closely related to each other than to other taxons outside this cladistical tree. If you chase this idea far enough you end up with one ancestor to all chordates and so on.
Of course, a percentage of genotype does not in any way indicate similarity or difference in phenotype. 1% difference - or 0.01% difference - can be huge if those different genes code completely different proteins which effect the procreative differences between the populations.
Now I KNOW you didn't read my earlier post. Go read it now please. I said this - in more detail, correctly (morphology has nothing to do with modern cladistics, thanks), with mechanisms. Sheesh.
Molecular biology and evolutionary biology are very complex fields of science. The evolution is only directed at fitness - whoever breeds the most, under the specific circumstances, has the most offspring. It's quite simply and very complicated, both at the same time.
And?
Again, you're doing nothing more than reiterating points I've already made, in a more simplistic fashion to boot. I'm discussing mechanisms of evolution - you're rehashing high school biology. Which would be fine, except I've already posted a simplification of a post-graduate evolution-development summation.
-
I notice you're both claiming I support your points.
Nope. I said that I disagreed with Goober's assessment that your posts said I was wrong.
Fair enough. Neither of you are wrong. =)
-
I can easily [believe the world was created 5000 years ago].
Quick question; can you remember who initially taught you this? Pastor? Family member?
-
You need to read carefully before replying, Janus. Both my posts.
[words]
U NEED TO READ MEIN KUSTOM TITLE RARARAGRARAG
Ok fine fine fine, whatever, point, but if you define advancement in terms of adaptability then how advanced are rat, raven and house fly? I mean, by this definition every single species is more "advanced" than any previous species:
I defined "advancement" as an increased rate of survival, or, greater fitness. Species are constantly fluctuating in fitness - which is why some die, some survive. Hence my discussion about "point" evaluation. Please make an effort to read and understand what I'm getting at before running off. "Qualitative supremacy" as you put it is fitness; we exist, our ancestors don't. Homo sapiens has greater fitness than Australopithecus, to choose an example - otherwise they'd be around today (primate evolution occurs by differentiation and reproductive isolation, as with most species).
-
I'm not saying we're more advanced than some species of insects because we build computers, I'm saying we're more advanced than some spcies of insects because humans live and breed in every place on Earth, while the particular insect species I'm referring to are dying out as their habitat is destroyed. We've adapted - they didn't. We're more advanced - or more fit.
Won't virus and bacteria be the most advanced lifeforms then?
-
That's the great irony: the more successful so called 'advanced' life is, the so much more successful viruses are.
Hell, we've sent bacteria to the moon and mars, and probably even to Titan despite NASA's claims that "we got them all this time..."
-
I'm not saying we're more advanced than some species of insects because we build computers, I'm saying we're more advanced than some spcies of insects because humans live and breed in every place on Earth, while the particular insect species I'm referring to are dying out as their habitat is destroyed. We've adapted - they didn't. We're more advanced - or more fit.
Won't virus and bacteria be the most advanced lifeforms then?
Some particular bacteria are arguably the most advanced form of life on Earth. They're also one of the simplest. Go figure. Archaea are even stranger.
Viruses are more complicated, because there is considerable debate over whether or not they are actually forms of life. If you include viruses, however, arguably the most advanced form of life on Earth is Human papilloma virus, which over 80% of the population carries (harmlessly).
-
Earth is a sphere. The Earth is 6-10k years old. No joke.
Since I've heard to many shoddy arguments from creationists about how faulty dating by radio-isotopes is, food for thought:
http://chem.tufts.edu/science/astronomy/SN1987A.html (http://chem.tufts.edu/science/astronomy/SN1987A.html)
A nice straight-forward proof that the universe is at least 168'000 years old, using basic physics and trigonometry.
-
Very nice proof.
What fo creationists think about Dinosaurs, sea scorpions and other prehistoric creatures? Geez...
-
The two explanations I hear most often are
1) They're the bodies of creatures that died in The Great Flood
2) They were put there deliberately by God to test everyone's faith.
-
They're two stupid explananations.
I simply can't believe the creationists exist. Maybe God put them here deliberately to test our faith on(in?)science.
-
Nay, they were 'intelligently designed' for our humor.
Afterall this Saturday morning 'Dr. Dino' as he called himself said that black people have souls.
Fools, no meatbags have souls! Only perfect... immortal... machines have souls.
Robot Jesus shall smite him for his blasphemy!
-
Robot Jesus shall smite him for his blasphemy!
Pfft, Zombie Jesus could kick Robot Jesus' ass... if Robot Jesus had an ass.
-
I do find it moderately amusing that some creationists are complaining because Religion is finding itself confronted by a group of people who have information so complex and difficult to understand that the average person can only accept general facts, because details require a degree in Biology. In many ways, ironically enough, it is similar in effect to the technique used in the 16th century by the church, right up until the first translations to English started to appear.
I'm afraid that 'it's too complex to understand it!' didn't work for my Pure Maths tutor, and it doesn't work for investigating the origins of life.
And my moneys on Robot Zombie Monkey Jesus with Rocket Launcher Tail (tm).
-
Robot Jesus shall smite him for his blasphemy!
Pfft, Zombie Jesus could kick Robot Jesus' ass... if Robot Jesus had an ass.
You can kiss his shiny metal ass thank you!
Yes, the problem with modern academia is the exact same problem as the Church before the Reformation. Having to rely on limited resources for research with limited publishing means that information doesn't get out to the public.
Why the hell in every archaeology class when I'm stuck with a non-major am I stuck doing 'Egypt' instead of other civilizations just as complex? Because the knowledge isn't getting out there.
Let's face it, good easily digestible and accurate scientific knowledge isn't getting out there. We have what... Nova... and that's about it. ...and half of the few things left on the Discovery channel are pretty damn inaccurate due to being so dated.
The real trick is moreso getting information out quick and to as many as possible.
With the technology we now have it's also a lot easier to give people things they can play and explore with.
Think radiocarbon dating is bunk? Well here's a 3d model of how AMR works, and you can play with the particle accelerator and atoms while also looking at some photos of the dig site.
Pretty much programs like Celestia but made prettier, more accessible, and more data.
-
Disgaea's Celestia? :lol:
-
it really is sad that the discovery channel has turned into a reality TV and fiction channel
-
it really is sad that the discovery channel has turned into a reality TV and fiction channel
Agreed, TLC also used to have some substance but now its all repetitive reality show rejects, home and garden crap, and other BS. The few music videos MTV does display are cut to under a minute to fit the attention span, littered with pesky commentary and huge flashing visual artifacts, and the most annoying filler in between - stupid teenagers sitting on a crowded beach doing absolutley nothing.
The History Channel seems to get better though. They keep it tr00.
-
What's the History Channel?
Ohhhhh, you must mean the Hitler Footage Channel.
-
it really is sad that the discovery channel has turned into a reality TV and fiction channel
Agreed, TLC also used to have some substance but now its all repetitive reality show rejects, home and garden crap, and other BS. The few music videos MTV does display are cut to under a minute to fit the attention span, littered with pesky commentary and huge flashing visual artifacts, and the most annoying filler in between - stupid teenagers sitting on a crowded beach doing absolutley nothing.
The History Channel seems to get better though. They keep it tr00.
Just don't believe a word they say about WWII aviation. I can attest to that and poke giant gaping holes in any of their aviation shows :)
-
I'm not saying we're more advanced than some species of insects because we build computers, I'm saying we're more advanced than some spcies of insects because humans live and breed in every place on Earth, while the particular insect species I'm referring to are dying out as their habitat is destroyed. We've adapted - they didn't. We're more advanced - or more fit.
Won't virus and bacteria be the most advanced lifeforms then?
Some particular bacteria are arguably the most advanced form of life on Earth. They're also one of the simplest. Go figure. Archaea are even stranger.
Viruses are more complicated, because there is considerable debate over whether or not they are actually forms of life. If you include viruses, however, arguably the most advanced form of life on Earth is Human papilloma virus, which over 80% of the population carries (harmlessly).
Doesn't that make advanced a null point anyways? Advanced = alive and doing well at some point. Seems completely unnecessary and arbitrary definition.
-
it really is sad that the discovery channel has turned into a reality TV and fiction channel
The History Channel seems to get better though. They keep it tr00.
Not really they're tunnel visioned on World War II and Rome, and even then there's gaping holes and inaccurate editorializing.
Their stuff on even earlier civilizations is utterly laughable...